Incidental Mutation 'R0256:Cdh6'
ID34753
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
MMRRC Submission 038487-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.416) question?
Stock #R0256 (G1)
Quality Score122
Status Validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 13053782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000036439
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.6%
  • 10x: 95.8%
  • 20x: 92.8%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,917,773 V552L probably benign Het
9330159F19Rik G T 10: 29,222,256 L186F probably damaging Het
Abce1 A C 8: 79,685,943 probably null Het
Acvrl1 A T 15: 101,137,121 N254Y probably damaging Het
Apip T A 2: 103,088,571 M72K possibly damaging Het
Arg1 A G 10: 24,916,458 Y188H probably benign Het
Armc3 A T 2: 19,269,216 N354Y probably damaging Het
Arrdc5 A G 17: 56,294,382 F248L probably damaging Het
Atp8b5 T C 4: 43,302,576 probably benign Het
Ccdc154 C T 17: 25,170,632 A490V probably benign Het
Chmp2b G T 16: 65,540,192 T193K probably benign Het
Clca3a1 A T 3: 144,730,879 N814K probably damaging Het
Cmtr1 T C 17: 29,697,124 L576P probably damaging Het
Fhl5 T C 4: 25,213,624 H104R probably benign Het
Foxk1 A G 5: 142,453,681 probably benign Het
Gm11596 T A 11: 99,792,716 T193S unknown Het
Gm15217 A T 14: 46,380,396 probably benign Het
Hic2 A G 16: 17,257,513 I69V probably benign Het
Ivl T C 3: 92,571,843 D305G probably damaging Het
Kcnn2 A G 18: 45,592,405 T323A probably damaging Het
Krt7 C T 15: 101,423,309 Q336* probably null Het
Krt73 T G 15: 101,801,936 D121A probably damaging Het
Mok T C 12: 110,808,105 D216G probably damaging Het
Muc3 A G 5: 137,146,691 C44R probably damaging Het
Muc5b A G 7: 141,841,395 Y46C unknown Het
Muc5b T C 7: 141,843,258 F223L unknown Het
Noct A G 3: 51,250,474 D411G probably damaging Het
Olfr1106 T C 2: 87,049,056 Y60C probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr813 A T 10: 129,857,037 D173V probably damaging Het
Pigv T C 4: 133,665,751 H36R probably damaging Het
Plscr3 A G 11: 69,850,054 K239E probably damaging Het
Prkag3 T C 1: 74,741,171 D445G probably benign Het
Ramp1 A T 1: 91,196,919 probably benign Het
Ror1 T A 4: 100,409,745 H214Q probably benign Het
Selenbp2 A T 3: 94,699,701 H156L probably benign Het
Slc28a3 T C 13: 58,573,500 T284A probably benign Het
Slc35a1 T C 4: 34,668,962 T284A probably benign Het
Smco2 A T 6: 146,861,746 I184F probably damaging Het
Son A G 16: 91,656,584 M740V possibly damaging Het
Stil T A 4: 115,023,685 N475K possibly damaging Het
Sval3 A G 6: 41,972,905 D122G probably damaging Het
Tnks A G 8: 34,861,547 M623T probably benign Het
Zfp142 A G 1: 74,578,158 V235A probably benign Het
Zfp423 A T 8: 87,773,634 C1053* probably null Het
Zfp648 T A 1: 154,205,668 D524E probably benign Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13044719 missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1240:Cdh6 UTSW 15 13057455 missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R2507:Cdh6 UTSW 15 13041361 missense probably benign 0.10
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5313:Cdh6 UTSW 15 13034637 missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13041460 missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
R7369:Cdh6 UTSW 15 13042638 missense probably damaging 0.99
R7506:Cdh6 UTSW 15 13034310 missense probably damaging 1.00
R8121:Cdh6 UTSW 15 13044671 missense probably damaging 1.00
R8801:Cdh6 UTSW 15 13044761 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCCAGAAGTCACCATCATGTC -3'
(R):5'- AGTGTCTGCCTCACCATGTGTTTG -3'

Sequencing Primer
(F):5'- tgctcgaccacctagcc -3'
(R):5'- GTTTAAGACCCCCGAGTCC -3'
Posted On2013-05-09