Mutagenetix > Incidental Mutation

Incidental Mutation 'R0256:Krt73'

34755

Institutional Source

Beutler Lab

Gene Symbol

Krt73

Ensembl Gene

ENSMUSG00000063661

Gene Name

keratin 73

Synonyms

MMRRC Submission

038487-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R0256 (G1)

Quality Score

172

Status

Validated

Chromosome

Chromosomal Location

101793308-101802346 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 101801936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 121 (D121A)

Ref Sequence

ENSEMBL: ENSMUSP00000065349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063292]

AlphaFold

Q6NXH9

Predicted Effect

probably damaging
Transcript: ENSMUST00000063292
AA Change: D121A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000065349
Gene: ENSMUSG00000063661
AA Change: D121A

Domain	Start	End	E-Value	Type
low complexity region	17	57	N/A	INTRINSIC
Pfam:Keratin_2_head	59	127	1.4e-19	PFAM
Filament	130	443	5.39e-159	SMART
low complexity region	450	461	N/A	INTRINSIC
low complexity region	466	481	N/A	INTRINSIC

Meta Mutation Damage Score

0.4688

Coding Region Coverage

1x: 98.6%
3x: 97.6%
10x: 95.8%
20x: 92.8%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	G	T	3: 36,917,773	V552L	probably benign	Het
9330159F19Rik	G	T	10: 29,222,256	L186F	probably damaging	Het
Abce1	A	C	8: 79,685,943		probably null	Het
Acvrl1	A	T	15: 101,137,121	N254Y	probably damaging	Het
Apip	T	A	2: 103,088,571	M72K	possibly damaging	Het
Arg1	A	G	10: 24,916,458	Y188H	probably benign	Het
Armc3	A	T	2: 19,269,216	N354Y	probably damaging	Het
Arrdc5	A	G	17: 56,294,382	F248L	probably damaging	Het
Atp8b5	T	C	4: 43,302,576		probably benign	Het
Ccdc154	C	T	17: 25,170,632	A490V	probably benign	Het
Cdh6	T	C	15: 13,053,782		probably benign	Het
Chmp2b	G	T	16: 65,540,192	T193K	probably benign	Het
Clca3a1	A	T	3: 144,730,879	N814K	probably damaging	Het
Cmtr1	T	C	17: 29,697,124	L576P	probably damaging	Het
Fhl5	T	C	4: 25,213,624	H104R	probably benign	Het
Foxk1	A	G	5: 142,453,681		probably benign	Het
Gm11596	T	A	11: 99,792,716	T193S	unknown	Het
Gm15217	A	T	14: 46,380,396		probably benign	Het
Hic2	A	G	16: 17,257,513	I69V	probably benign	Het
Ivl	T	C	3: 92,571,843	D305G	probably damaging	Het
Kcnn2	A	G	18: 45,592,405	T323A	probably damaging	Het
Krt7	C	T	15: 101,423,309	Q336*	probably null	Het
Mok	T	C	12: 110,808,105	D216G	probably damaging	Het
Muc3	A	G	5: 137,146,691	C44R	probably damaging	Het
Muc5b	A	G	7: 141,841,395	Y46C	unknown	Het
Muc5b	T	C	7: 141,843,258	F223L	unknown	Het
Noct	A	G	3: 51,250,474	D411G	probably damaging	Het
Olfr1106	T	C	2: 87,049,056	Y60C	probably damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Olfr813	A	T	10: 129,857,037	D173V	probably damaging	Het
Pigv	T	C	4: 133,665,751	H36R	probably damaging	Het
Plscr3	A	G	11: 69,850,054	K239E	probably damaging	Het
Prkag3	T	C	1: 74,741,171	D445G	probably benign	Het
Ramp1	A	T	1: 91,196,919		probably benign	Het
Ror1	T	A	4: 100,409,745	H214Q	probably benign	Het
Selenbp2	A	T	3: 94,699,701	H156L	probably benign	Het
Slc28a3	T	C	13: 58,573,500	T284A	probably benign	Het
Slc35a1	T	C	4: 34,668,962	T284A	probably benign	Het
Smco2	A	T	6: 146,861,746	I184F	probably damaging	Het
Son	A	G	16: 91,656,584	M740V	possibly damaging	Het
Stil	T	A	4: 115,023,685	N475K	possibly damaging	Het
Sval3	A	G	6: 41,972,905	D122G	probably damaging	Het
Tnks	A	G	8: 34,861,547	M623T	probably benign	Het
Zfp142	A	G	1: 74,578,158	V235A	probably benign	Het
Zfp423	A	T	8: 87,773,634	C1053*	probably null	Het
Zfp648	T	A	1: 154,205,668	D524E	probably benign	Het

Other mutations in Krt73

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01082:Krt73	APN	15	101798937	critical splice acceptor site	probably null
IGL01768:Krt73	APN	15	101798856	missense	probably benign	0.01
IGL01836:Krt73	APN	15	101795896	missense	probably benign	0.38
IGL02058:Krt73	APN	15	101802021	missense	probably benign
IGL02063:Krt73	APN	15	101795769	splice site	probably benign
IGL02076:Krt73	APN	15	101799935	missense	probably damaging	1.00
IGL02878:Krt73	APN	15	101798826	missense	probably damaging	1.00
IGL03127:Krt73	APN	15	101795840	missense	probably benign
R0032:Krt73	UTSW	15	101794052	missense	probably benign	0.30
R0109:Krt73	UTSW	15	101796395	nonsense	probably null
R0143:Krt73	UTSW	15	101800773	missense	probably damaging	1.00
R0233:Krt73	UTSW	15	101802016	missense	probably benign	0.12
R0233:Krt73	UTSW	15	101802016	missense	probably benign	0.12
R0254:Krt73	UTSW	15	101799889	splice site	probably benign
R0497:Krt73	UTSW	15	101802230	missense	probably damaging	0.99
R1592:Krt73	UTSW	15	101802239	nonsense	probably null
R1681:Krt73	UTSW	15	101802047	missense	possibly damaging	0.70
R1696:Krt73	UTSW	15	101799909	missense	probably damaging	1.00
R1766:Krt73	UTSW	15	101793928	missense	probably damaging	1.00
R2031:Krt73	UTSW	15	101798764	splice site	probably benign
R2171:Krt73	UTSW	15	101800910	missense	possibly damaging	0.88
R4674:Krt73	UTSW	15	101802075	missense	probably benign	0.22
R4777:Krt73	UTSW	15	101794001	missense	probably benign
R4869:Krt73	UTSW	15	101796398	missense	probably damaging	1.00
R4892:Krt73	UTSW	15	101795809	missense	probably damaging	0.99
R5794:Krt73	UTSW	15	101794829	missense	probably benign	0.00
R6807:Krt73	UTSW	15	101796407	missense	probably damaging	1.00
R6885:Krt73	UTSW	15	101796398	missense	probably damaging	1.00
R7489:Krt73	UTSW	15	101793859	missense	probably benign	0.00
R7682:Krt73	UTSW	15	101802045	missense	probably benign	0.08
R9167:Krt73	UTSW	15	101793970	missense	probably benign	0.00
R9795:Krt73	UTSW	15	101802290	missense	probably damaging	1.00
Z1177:Krt73	UTSW	15	101793811	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATTTTGCACCTCCCAAGGCTAC -3'
(R):5'- CCCAGGAGCATCTCCTTCAATGTG -3'

Sequencing Primer
(F):5'- CTATGTCCTGGAAAAGGGTAGCATC -3'
(R):5'- GATATGGGTTTGGCCGGAAT -3'

Posted On

2013-05-09