Incidental Mutation 'R0257:St18'
ID34763
Institutional Source Beutler Lab
Gene Symbol St18
Ensembl Gene ENSMUSG00000033740
Gene Namesuppression of tumorigenicity 18
SynonymsNzf3, Myt3
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0257 (G1)
Quality Score161
Status Validated
Chromosome1
Chromosomal Location6487231-6860940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6819962 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 539 (F539L)
Ref Sequence ENSEMBL: ENSMUSP00000131417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043578] [ENSMUST00000131494] [ENSMUST00000140079] [ENSMUST00000150761] [ENSMUST00000151281] [ENSMUST00000163727]
Predicted Effect probably benign
Transcript: ENSMUST00000043578
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000042056
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131494
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117789
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140079
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118322
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142304
Predicted Effect probably benign
Transcript: ENSMUST00000150761
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000120298
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151281
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000122055
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 363 393 2.6e-17 PFAM
Pfam:zf-C2HC 407 437 1e-18 PFAM
Pfam:MYT1 476 714 1.5e-116 PFAM
Pfam:zf-C2HC 719 749 1e-19 PFAM
Pfam:zf-C2HC 763 793 1.3e-20 PFAM
Pfam:zf-C2HC 811 841 8.9e-19 PFAM
Pfam:zf-C2HC 864 894 1.3e-16 PFAM
coiled coil region 918 987 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163727
AA Change: F539L

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131417
Gene: ENSMUSG00000033740
AA Change: F539L

DomainStartEndE-ValueType
low complexity region 188 198 N/A INTRINSIC
Pfam:zf-C2HC 365 392 7.8e-15 PFAM
Pfam:zf-C2HC 409 437 4.2e-17 PFAM
Pfam:MYT1 476 713 1.3e-75 PFAM
Pfam:zf-C2HC 721 749 4e-19 PFAM
Pfam:zf-C2HC 765 793 1.7e-19 PFAM
Pfam:zf-C2HC 813 841 1.1e-17 PFAM
Pfam:zf-C2HC 866 893 9.1e-15 PFAM
coiled coil region 918 987 N/A INTRINSIC
Meta Mutation Damage Score 0.1045 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in St18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:St18 APN 1 6802572 missense probably benign 0.07
IGL00840:St18 APN 1 6833594 missense probably damaging 1.00
IGL01016:St18 APN 1 6844323 missense probably damaging 0.98
IGL01116:St18 APN 1 6802632 missense probably damaging 0.96
IGL01719:St18 APN 1 6845796 splice site probably benign
IGL01885:St18 APN 1 6844372 critical splice donor site probably null
IGL02486:St18 APN 1 6820083 missense probably damaging 1.00
IGL02611:St18 APN 1 6768890 splice site probably benign
IGL02742:St18 APN 1 6802316 splice site probably benign
IGL02953:St18 APN 1 6844113 splice site probably benign
IGL02999:St18 APN 1 6817605 missense probably benign 0.01
IGL03092:St18 APN 1 6768894 splice site probably benign
Smallish UTSW 1 6855473 critical splice donor site probably null
IGL03055:St18 UTSW 1 6802735 missense probably damaging 0.99
R0089:St18 UTSW 1 6848948 missense probably benign 0.02
R0383:St18 UTSW 1 6803024 missense probably damaging 1.00
R0588:St18 UTSW 1 6817738 missense probably damaging 0.99
R0989:St18 UTSW 1 6827881 missense probably benign 0.04
R1068:St18 UTSW 1 6795562 missense probably benign 0.01
R1311:St18 UTSW 1 6845644 missense probably damaging 1.00
R1530:St18 UTSW 1 6845569 critical splice acceptor site probably null
R1723:St18 UTSW 1 6810685 splice site probably benign
R1926:St18 UTSW 1 6802689 missense probably benign 0.00
R1927:St18 UTSW 1 6802712 missense probably benign 0.00
R2035:St18 UTSW 1 6802328 missense probably benign 0.00
R2091:St18 UTSW 1 6827971 missense probably benign 0.08
R2139:St18 UTSW 1 6810615 missense possibly damaging 0.85
R2261:St18 UTSW 1 6845572 missense probably damaging 0.96
R2300:St18 UTSW 1 6855402 missense probably damaging 1.00
R2322:St18 UTSW 1 6844124 nonsense probably null
R2846:St18 UTSW 1 6845587 missense probably damaging 0.96
R3738:St18 UTSW 1 6855473 critical splice donor site probably null
R3739:St18 UTSW 1 6855473 critical splice donor site probably null
R3772:St18 UTSW 1 6844329 missense probably damaging 1.00
R3805:St18 UTSW 1 6802353 missense probably damaging 1.00
R3953:St18 UTSW 1 6802893 missense probably damaging 0.99
R4034:St18 UTSW 1 6855473 critical splice donor site probably null
R4036:St18 UTSW 1 6827786 missense probably damaging 1.00
R4407:St18 UTSW 1 6827837 missense probably benign 0.29
R4527:St18 UTSW 1 6855423 missense probably damaging 1.00
R4740:St18 UTSW 1 6817604 missense probably benign
R4838:St18 UTSW 1 6802905 missense probably benign 0.01
R5182:St18 UTSW 1 6817653 missense probably benign 0.03
R5186:St18 UTSW 1 6802317 splice site probably null
R5354:St18 UTSW 1 6844171 missense probably damaging 1.00
R5423:St18 UTSW 1 6802616 missense possibly damaging 0.91
R5724:St18 UTSW 1 6770950 missense probably benign 0.13
R6182:St18 UTSW 1 6844118 splice site probably null
R6491:St18 UTSW 1 6827985 nonsense probably null
R6503:St18 UTSW 1 6795397 missense probably damaging 1.00
R7037:St18 UTSW 1 6803036 missense possibly damaging 0.65
R7098:St18 UTSW 1 6827842 missense probably damaging 1.00
R7132:St18 UTSW 1 6859127 missense
R7144:St18 UTSW 1 6833594 missense probably damaging 1.00
R7150:St18 UTSW 1 6803019 missense probably damaging 1.00
R7334:St18 UTSW 1 6802559 missense probably benign 0.00
R7502:St18 UTSW 1 6827970 missense probably benign 0.09
R7729:St18 UTSW 1 6802537 missense probably benign 0.00
R7848:St18 UTSW 1 6857445 critical splice donor site probably null
R8088:St18 UTSW 1 6828005 missense probably benign 0.00
R8299:St18 UTSW 1 6802992 missense probably benign 0.01
R8338:St18 UTSW 1 6809292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGAGAGCAGGCACACTCCCAAG -3'
(R):5'- CCATGAACGGACGCAGTTGAGAAC -3'

Sequencing Primer
(F):5'- CTTAAGAGAATAGGCCCCTTTCATC -3'
(R):5'- GAACATGAAAGGCAGTTGATTCTC -3'
Posted On2013-05-09