Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Cfh'

34765

Institutional Source

Beutler Lab

Gene Symbol

Cfh

Ensembl Gene

ENSMUSG00000026365

Gene Name

complement component factor h

Synonyms

Mud-1, Sas1, Sas-1

MMRRC Submission

038488-MU

Accession Numbers

Genbank: NM_009888; MGI: 88385

Essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R0257 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

140084708-140183764 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 140144035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 287 (D287G)

Ref Sequence

ENSEMBL: ENSMUSP00000066677 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066859] [ENSMUST00000111976] [ENSMUST00000111977] [ENSMUST00000123238] [ENSMUST00000192880]

AlphaFold

P06909

PDB Structure

Structure of domains 6 and 7 of the mouse complement regulator Factor H [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000066859
AA Change: D287G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000066677
Gene: ENSMUSG00000026365
AA Change: D287G

Domain	Start	End	E-Value	Type
CCP	21	80	7.75e-8	SMART
CCP	85	141	2.17e-11	SMART
CCP	146	205	7.5e-15	SMART
CCP	210	262	6.29e-8	SMART
CCP	267	320	2.04e-7	SMART
CCP	325	385	6.35e-4	SMART
CCP	389	442	1.15e-10	SMART
CCP	448	505	3.62e-8	SMART
CCP	509	564	6.45e-5	SMART
CCP	569	622	5.56e-9	SMART
CCP	629	683	3.45e-14	SMART
CCP	690	743	1.82e-13	SMART
CCP	752	802	6.59e-1	SMART
CCP	808	861	1.04e-8	SMART
CCP	867	931	4.66e-11	SMART
CCP	936	989	3.9e-13	SMART
CCP	994	1048	1.4e-14	SMART
CCP	1053	1107	2.09e-13	SMART
CCP	1114	1168	8.04e-15	SMART
CCP	1172	1233	5.57e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111976
AA Change: D305G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107607
Gene: ENSMUSG00000026365
AA Change: D305G

Domain	Start	End	E-Value	Type
CCP	39	98	7.75e-8	SMART
CCP	103	159	2.17e-11	SMART
CCP	164	223	7.5e-15	SMART
CCP	228	280	6.29e-8	SMART
CCP	285	338	2.04e-7	SMART
CCP	343	403	6.35e-4	SMART
CCP	407	460	1.15e-10	SMART
CCP	466	523	3.62e-8	SMART
CCP	527	582	6.45e-5	SMART
CCP	587	640	5.56e-9	SMART
CCP	647	701	3.45e-14	SMART
CCP	708	761	1.82e-13	SMART
CCP	770	820	6.59e-1	SMART
CCP	826	879	1.04e-8	SMART
CCP	885	949	4.66e-11	SMART
CCP	954	1007	3.9e-13	SMART
CCP	1012	1066	1.4e-14	SMART
CCP	1071	1125	2.09e-13	SMART
CCP	1132	1186	8.04e-15	SMART
CCP	1190	1251	5.57e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111977
AA Change: D305G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107608
Gene: ENSMUSG00000026365
AA Change: D305G

Domain	Start	End	E-Value	Type
CCP	21	80	7.75e-8	SMART
CCP	85	141	2.17e-11	SMART
CCP	146	205	7.5e-15	SMART
CCP	210	262	6.29e-8	SMART
CCP	267	320	2.04e-7	SMART
CCP	325	385	6.35e-4	SMART
CCP	389	442	1.15e-10	SMART
CCP	448	505	3.62e-8	SMART
CCP	509	564	6.45e-5	SMART
CCP	572	626	3.45e-14	SMART
CCP	633	686	1.82e-13	SMART
CCP	695	745	6.59e-1	SMART
CCP	751	804	1.04e-8	SMART
CCP	810	874	4.66e-11	SMART
CCP	879	932	3.9e-13	SMART
CCP	937	991	1.4e-14	SMART
CCP	996	1050	2.09e-13	SMART
CCP	1057	1111	8.04e-15	SMART
CCP	1115	1176	5.57e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123238
AA Change: D287G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000115166
Gene: ENSMUSG00000026365
AA Change: D287G

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
CCP	21	80	7.75e-8	SMART
CCP	85	141	2.17e-11	SMART
CCP	146	205	7.5e-15	SMART
CCP	210	262	6.29e-8	SMART
CCP	267	320	2.04e-7	SMART
CCP	325	385	6.35e-4	SMART
CCP	389	442	1.15e-10	SMART
CCP	448	505	3.62e-8	SMART
CCP	509	564	6.45e-5	SMART
CCP	569	622	5.56e-9	SMART
CCP	629	683	3.45e-14	SMART
CCP	690	743	1.82e-13	SMART
CCP	752	802	6.59e-1	SMART
CCP	808	861	1.04e-8	SMART
CCP	867	931	4.66e-11	SMART
CCP	936	989	3.9e-13	SMART
CCP	994	1048	1.4e-14	SMART
CCP	1053	1107	2.09e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148225

Predicted Effect

probably benign
Transcript: ENSMUST00000192880
AA Change: D305G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000141209
Gene: ENSMUSG00000026365
AA Change: D305G

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CCP	39	98	3.9e-10	SMART
CCP	103	159	1e-13	SMART
CCP	164	223	3.7e-17	SMART
CCP	228	280	3.1e-10	SMART
CCP	285	338	9.9e-10	SMART
CCP	343	403	3.2e-6	SMART
CCP	407	460	5.6e-13	SMART
CCP	467	521	6.7e-17	SMART
CCP	526	580	1e-15	SMART
CCP	587	641	3.8e-17	SMART
CCP	645	706	2.7e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000192919

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Regulator of Complement Activation (RCA) gene cluster and encodes a protein with twenty short consensus repeat (SCR) domains. This protein is secreted into the bloodstream and has an essential role in the regulation of complement activation, restricting this innate defense mechanism to microbial infections. Mutations in this gene have been associated with hemolytic-uremic syndrome (HUS) and chronic hypocomplementemic nephropathy. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutation of this gene results in markedly reduced serum C3, abnormal renal histology, spontaneous membranoproliferative glomerulonephritis (MPGN), hematuria, proteinuria, and increased mortality at 8 months of age. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Cfh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00969:Cfh	APN	1	140088682	missense	probably damaging	1.00
IGL01124:Cfh	APN	1	140183261	missense	probably benign	0.01
IGL01389:Cfh	APN	1	140154639	missense	probably benign	0.44
IGL01455:Cfh	APN	1	140105539	missense	possibly damaging	0.51
IGL01877:Cfh	APN	1	140100829	missense	probably damaging	1.00
IGL02836:Cfh	APN	1	140102399	missense	probably damaging	1.00
IGL02937:Cfh	APN	1	140105442	missense	probably benign	0.19
IGL03039:Cfh	APN	1	140136261	missense	possibly damaging	0.86
IGL03069:Cfh	APN	1	140099055	intron	probably benign
IGL03192:Cfh	APN	1	140099021	missense	possibly damaging	0.71
IGL03201:Cfh	APN	1	140102819	missense	probably damaging	1.00
3-1:Cfh	UTSW	1	140163125	missense	probably damaging	1.00
PIT4449001:Cfh	UTSW	1	140112565	missense	probably damaging	1.00
R0294:Cfh	UTSW	1	140183261	missense	probably benign	0.01
R0571:Cfh	UTSW	1	140102333	splice site	probably null
R0576:Cfh	UTSW	1	140136815	missense	probably damaging	0.99
R0586:Cfh	UTSW	1	140183182	missense	probably damaging	0.98
R0605:Cfh	UTSW	1	140102358	missense	probably damaging	1.00
R0617:Cfh	UTSW	1	140100883	missense	probably benign	0.01
R0725:Cfh	UTSW	1	140157343	splice site	probably benign
R0853:Cfh	UTSW	1	140105490	missense	probably damaging	1.00
R1430:Cfh	UTSW	1	140102698	splice site	probably benign
R1500:Cfh	UTSW	1	140100876	missense	probably damaging	1.00
R1533:Cfh	UTSW	1	140100978	missense	possibly damaging	0.86
R1667:Cfh	UTSW	1	140105523	missense	probably benign	0.01
R1695:Cfh	UTSW	1	140102837	missense	probably damaging	0.98
R1728:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1729:Cfh	UTSW	1	140136788	missense	probably benign	0.02
R1729:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1730:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1739:Cfh	UTSW	1	140136788	missense	probably benign	0.02
R1739:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1756:Cfh	UTSW	1	140100877	missense	probably damaging	1.00
R1762:Cfh	UTSW	1	140136788	missense	probably benign	0.02
R1762:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1783:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1784:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1785:Cfh	UTSW	1	140136788	missense	probably benign	0.02
R1785:Cfh	UTSW	1	140147697	missense	possibly damaging	0.55
R1912:Cfh	UTSW	1	140136141	splice site	probably null
R2273:Cfh	UTSW	1	140102825	missense	probably damaging	1.00
R2288:Cfh	UTSW	1	140098901	missense	possibly damaging	0.70
R3725:Cfh	UTSW	1	140086496	missense	probably damaging	0.99
R3731:Cfh	UTSW	1	140119970	missense	possibly damaging	0.71
R4060:Cfh	UTSW	1	140119926	missense	possibly damaging	0.91
R4192:Cfh	UTSW	1	140102716	missense	possibly damaging	0.50
R4226:Cfh	UTSW	1	140108926	missense	probably damaging	1.00
R4425:Cfh	UTSW	1	140100875	nonsense	probably null
R4431:Cfh	UTSW	1	140136266	missense	probably damaging	1.00
R4712:Cfh	UTSW	1	140108536	missense	probably damaging	1.00
R4755:Cfh	UTSW	1	140088808	missense	probably damaging	1.00
R4792:Cfh	UTSW	1	140100823	nonsense	probably null
R4831:Cfh	UTSW	1	140086387	missense	probably benign
R5052:Cfh	UTSW	1	140144044	missense	probably damaging	0.96
R5181:Cfh	UTSW	1	140147646	splice site	probably benign
R5205:Cfh	UTSW	1	140143970	missense	probably damaging	1.00
R5285:Cfh	UTSW	1	140100898	missense	probably benign	0.21
R5366:Cfh	UTSW	1	140136235	missense	probably damaging	1.00
R5776:Cfh	UTSW	1	140144023	missense	possibly damaging	0.83
R5914:Cfh	UTSW	1	140136229	missense	probably benign	0.39
R5948:Cfh	UTSW	1	140108808	missense	probably damaging	0.96
R5979:Cfh	UTSW	1	140118671	missense	possibly damaging	0.66
R6034:Cfh	UTSW	1	140163131	missense	probably damaging	0.98
R6034:Cfh	UTSW	1	140163131	missense	probably damaging	0.98
R6059:Cfh	UTSW	1	140118690	missense	possibly damaging	0.92
R6198:Cfh	UTSW	1	140105440	missense	probably damaging	1.00
R6306:Cfh	UTSW	1	140102417	missense	probably damaging	1.00
R6523:Cfh	UTSW	1	140101707	missense	possibly damaging	0.82
R6610:Cfh	UTSW	1	140101748	nonsense	probably null
R6652:Cfh	UTSW	1	140144068	missense	probably benign	0.39
R6852:Cfh	UTSW	1	140147749	missense	probably damaging	1.00
R6861:Cfh	UTSW	1	140100883	missense	probably benign	0.07
R6862:Cfh	UTSW	1	140102362	missense	probably damaging	1.00
R7065:Cfh	UTSW	1	140086402	missense	probably damaging	0.99
R7191:Cfh	UTSW	1	140112567	missense	probably benign	0.04
R7197:Cfh	UTSW	1	140088767	nonsense	probably null
R7355:Cfh	UTSW	1	140136815	missense	probably damaging	1.00
R7367:Cfh	UTSW	1	140086521	missense	probably damaging	0.97
R7419:Cfh	UTSW	1	140105466	missense	probably damaging	0.99
R7579:Cfh	UTSW	1	140108590	missense	possibly damaging	0.53
R7586:Cfh	UTSW	1	140147721	missense	probably damaging	0.99
R7985:Cfh	UTSW	1	140108826	missense	probably damaging	1.00
R8119:Cfh	UTSW	1	140120015	missense	possibly damaging	0.95
R8277:Cfh	UTSW	1	140101609	missense	probably damaging	1.00
R8742:Cfh	UTSW	1	140101652	missense	probably damaging	0.98
R8742:Cfh	UTSW	1	140136731	missense	probably damaging	0.97
R8743:Cfh	UTSW	1	140118585	critical splice donor site	probably null
R8874:Cfh	UTSW	1	140086421	missense	probably damaging	1.00
R8909:Cfh	UTSW	1	140086348	missense	possibly damaging	0.47
R8949:Cfh	UTSW	1	140098967	missense	probably damaging	0.98
R9126:Cfh	UTSW	1	140086373	missense	probably damaging	0.98
R9309:Cfh	UTSW	1	140154511	missense	probably damaging	0.99
R9441:Cfh	UTSW	1	140102411	missense	probably benign	0.08
R9502:Cfh	UTSW	1	140112582	missense	possibly damaging	0.85
R9544:Cfh	UTSW	1	140108528	missense	probably benign	0.14
R9559:Cfh	UTSW	1	140102537	missense	probably benign	0.32
R9616:Cfh	UTSW	1	140102516	missense	probably damaging	0.99
R9617:Cfh	UTSW	1	140162980	missense	possibly damaging	0.53
R9733:Cfh	UTSW	1	140088795	missense	probably damaging	1.00
R9748:Cfh	UTSW	1	140162949	critical splice donor site	probably null
R9788:Cfh	UTSW	1	140108761	missense	probably benign	0.01
T0975:Cfh	UTSW	1	140154598	missense	probably benign	0.05
Z1088:Cfh	UTSW	1	140108904	missense	probably benign	0.04
Z1088:Cfh	UTSW	1	140147718	missense	possibly damaging	0.77
Z1177:Cfh	UTSW	1	140144059	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGACAACAAAGGTTTGTTATGGGG -3'
(R):5'- AGAATCAAGGCCAGCAATTTCGATCA -3'

Sequencing Primer
(F):5'- TGGGGCAAATATTACTGAGATTTAC -3'
(R):5'- GCCAGCAATTTCGATCATAGAATTAG -3'

Posted On

2013-05-09