Incidental Mutation 'R0257:Stx16'
ID34770
Institutional Source Beutler Lab
Gene Symbol Stx16
Ensembl Gene ENSMUSG00000027522
Gene Namesyntaxin 16
SynonymsSYN16, 6330500A18Rik, 5430410K23Rik
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0257 (G1)
Quality Score205
Status Validated
Chromosome2
Chromosomal Location174076308-174099771 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 174096961 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 307 (V307M)
Ref Sequence ENSEMBL: ENSMUSP00000085218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044638] [ENSMUST00000087908] [ENSMUST00000147038] [ENSMUST00000155000]
Predicted Effect probably benign
Transcript: ENSMUST00000044638
AA Change: V308M

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039543
Gene: ENSMUSG00000027522
AA Change: V308M

DomainStartEndE-ValueType
Blast:SynN 76 190 2e-20 BLAST
t_SNARE 227 294 9.13e-23 SMART
transmembrane domain 305 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087908
AA Change: V307M

PolyPhen 2 Score 0.387 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000085218
Gene: ENSMUSG00000027522
AA Change: V307M

DomainStartEndE-ValueType
Pfam:Syntaxin 74 174 2.1e-15 PFAM
t_SNARE 226 293 9.13e-23 SMART
transmembrane domain 304 323 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147038
SMART Domains Protein: ENSMUSP00000120279
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 121 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155000
SMART Domains Protein: ENSMUSP00000119952
Gene: ENSMUSG00000027522

DomainStartEndE-ValueType
Pfam:Syntaxin 21 89 4.8e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000156054
AA Change: V256M
SMART Domains Protein: ENSMUSP00000116618
Gene: ENSMUSG00000027522
AA Change: V256M

DomainStartEndE-ValueType
Blast:SynN 73 187 5e-21 BLAST
Pfam:SNARE 217 258 6.6e-18 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and do not exhibit methylation abnormalities or develop a pseudohypoparathyroidism resistance phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Stx16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Stx16 APN 2 174092409 missense probably damaging 1.00
IGL01626:Stx16 APN 2 174094020 missense probably damaging 1.00
IGL03052:Stx16 UTSW 2 174092438 missense probably benign 0.01
R4929:Stx16 UTSW 2 174096928 missense possibly damaging 0.94
R5728:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5729:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5746:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5772:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5774:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R5776:Stx16 UTSW 2 174093499 missense probably damaging 0.98
R6147:Stx16 UTSW 2 174090687 missense probably damaging 1.00
R6837:Stx16 UTSW 2 174094002 missense probably benign 0.09
R8151:Stx16 UTSW 2 174093491 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- CGTTTACATTTGTCCCAGGCACGG -3'
(R):5'- TGCTCTTTACACAGTGCAGCGG -3'

Sequencing Primer
(F):5'- AGTAGGCCCAGTGTAACTTG -3'
(R):5'- GTGAGGCACCAGCCAAG -3'
Posted On2013-05-09