Incidental Mutation 'R0257:Rxfp1'
ID34772
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.219) question?
Stock #R0257 (G1)
Quality Score131
Status Validated
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79682535 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 100 (V100M)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078527
AA Change: V100M

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: V100M

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Meta Mutation Damage Score 0.1950 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0123:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79644975 missense probably damaging 1.00
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79705569 splice site probably null
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79644761 missense probably benign
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79678747 missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
R7530:Rxfp1 UTSW 3 79650461 missense probably benign 0.18
R7626:Rxfp1 UTSW 3 79648090 missense probably damaging 0.99
R7684:Rxfp1 UTSW 3 79670907 missense possibly damaging 0.66
R7951:Rxfp1 UTSW 3 79652375 missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Z1177:Rxfp1 UTSW 3 79652367 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACGCATTCTTAGTGATGACCCAGG -3'
(R):5'- CCCACCCATACGTTAGTCAGCATTC -3'

Sequencing Primer
(F):5'- GACGAGCCAATCTTTGCTAC -3'
(R):5'- ggactcacagacacacacac -3'
Posted On2013-05-09