Incidental Mutation 'R0257:Fktn'
ID34775
Institutional Source Beutler Lab
Gene Symbol Fktn
Ensembl Gene ENSMUSG00000028414
Gene Namefukutin
SynonymsFukutin, Fcmd
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0257 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location53713998-53777890 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53734898 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 179 (T179A)
Ref Sequence ENSEMBL: ENSMUSP00000152867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061771] [ENSMUST00000107638] [ENSMUST00000128667] [ENSMUST00000221657] [ENSMUST00000222290]
Predicted Effect probably benign
Transcript: ENSMUST00000061771
AA Change: T140A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061489
Gene: ENSMUSG00000028414
AA Change: T140A

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107638
SMART Domains Protein: ENSMUSP00000138774
Gene: ENSMUSG00000028414

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128667
AA Change: T140A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000114699
Gene: ENSMUSG00000028414
AA Change: T140A

DomainStartEndE-ValueType
transmembrane domain 7 28 N/A INTRINSIC
Pfam:LicD 288 393 2.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221657
AA Change: T179A

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000222290
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative transmembrane protein that is localized to the cis-Golgi compartment, where it may be involved in the glycosylation of alpha-dystroglycan in skeletal muscle. The encoded protein is thought to be a glycosyltransferase and could play a role in brain development. Defects in this gene are a cause of Fukuyama-type congenital muscular dystrophy (FCMD), Walker-Warburg syndrome (WWS), limb-girdle muscular dystrophy type 2M (LGMD2M), and dilated cardiomyopathy type 1X (CMD1X). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice die by E9.5. Embryos exhibit diverse phenotypes such as growth retardation, folding of the egg cylinder, leakage of maternal red blood cells into the yolk sac cavity, increased number of apoptotic cells in the ectoderm, and thin and breached basement membranes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Fktn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Fktn APN 4 53734866 missense probably benign 0.17
IGL00562:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00563:Fktn APN 4 53747007 critical splice acceptor site probably null
IGL00972:Fktn APN 4 53734992 missense probably damaging 1.00
IGL01025:Fktn APN 4 53737568 missense possibly damaging 0.51
IGL02329:Fktn APN 4 53720181 missense probably benign 0.40
IGL03149:Fktn APN 4 53744653 missense probably benign
IGL03310:Fktn APN 4 53720120 nonsense probably null
beijing UTSW 4 53734880 missense probably damaging 1.00
R0311:Fktn UTSW 4 53744620 missense probably benign 0.10
R1368:Fktn UTSW 4 53734880 missense probably damaging 1.00
R1500:Fktn UTSW 4 53735065 missense probably benign
R1654:Fktn UTSW 4 53761220 missense probably benign 0.01
R1757:Fktn UTSW 4 53747003 splice site probably benign
R2007:Fktn UTSW 4 53735099 missense possibly damaging 0.56
R4308:Fktn UTSW 4 53724617 intron probably benign
R4374:Fktn UTSW 4 53720201 missense probably damaging 0.99
R4798:Fktn UTSW 4 53744637 missense probably benign 0.01
R5563:Fktn UTSW 4 53761327 missense probably damaging 1.00
R5913:Fktn UTSW 4 53735035 nonsense probably null
R5997:Fktn UTSW 4 53735061 missense probably benign 0.00
R6227:Fktn UTSW 4 53731136 missense probably benign
R6942:Fktn UTSW 4 53735128 critical splice donor site probably null
R7832:Fktn UTSW 4 53734859 missense probably benign
R7915:Fktn UTSW 4 53734859 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGACAGTCTCCATTCTCCACAG -3'
(R):5'- TTGAGTCGTAGGTGACCATGCCAG -3'

Sequencing Primer
(F):5'- CACAGCTTTCTTTTGCTACTTTAG -3'
(R):5'- TGACCATGCCAGAGGTAGTTG -3'
Posted On2013-05-09