Incidental Mutation 'R0257:Wdr31'
ID 34777
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene Name WD repeat domain 31
Synonyms 5430402I10Rik
MMRRC Submission 038488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R0257 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 62366890-62389133 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 62378755 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
AlphaFold Q9JHB4
Predicted Effect probably null
Transcript: ENSMUST00000030087
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000030087
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107452
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107452
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120095
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120095
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153615
Predicted Effect probably benign
Transcript: ENSMUST00000155522
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T A 11: 84,401,107 (GRCm39) E171D probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adgre5 T A 8: 84,458,624 (GRCm39) H134L possibly damaging Het
Ahsg A T 16: 22,717,790 (GRCm39) M256L probably benign Het
Alk A T 17: 72,910,490 (GRCm39) L72Q probably damaging Het
Ano2 C A 6: 125,857,676 (GRCm39) A505E probably benign Het
Bcas3 A G 11: 85,712,865 (GRCm39) K908E probably benign Het
C3ar1 A G 6: 122,827,746 (GRCm39) V157A probably benign Het
Car2 C G 3: 14,965,037 (GRCm39) H224D probably benign Het
Cfh T C 1: 140,071,773 (GRCm39) D287G probably benign Het
Disp3 G T 4: 148,335,211 (GRCm39) N944K possibly damaging Het
Dlg1 A G 16: 31,661,671 (GRCm39) probably benign Het
Dmbt1 A G 7: 130,708,123 (GRCm39) E1281G probably damaging Het
Dmxl1 T A 18: 50,088,870 (GRCm39) probably benign Het
Dtx3 T C 10: 127,028,761 (GRCm39) D159G probably benign Het
Ets2 T A 16: 95,513,245 (GRCm39) C140* probably null Het
Fbf1 T C 11: 116,045,917 (GRCm39) I226V probably benign Het
Fgd6 T A 10: 93,879,777 (GRCm39) H210Q probably benign Het
Fktn A G 4: 53,734,898 (GRCm39) T179A probably benign Het
Galnt10 T C 11: 57,671,904 (GRCm39) M398T probably damaging Het
Grk5 G T 19: 61,065,068 (GRCm39) probably benign Het
Gse1 A G 8: 121,299,073 (GRCm39) probably benign Het
Hmcn2 T C 2: 31,259,176 (GRCm39) probably benign Het
Iqgap2 A G 13: 95,861,052 (GRCm39) probably null Het
Lama4 T C 10: 38,970,880 (GRCm39) probably benign Het
Luzp2 A G 7: 54,899,194 (GRCm39) T271A probably benign Het
Mdn1 T A 4: 32,693,534 (GRCm39) V1053D probably damaging Het
Mrm1 A C 11: 84,705,649 (GRCm39) probably benign Het
Msh5 G C 17: 35,251,840 (GRCm39) R407G probably damaging Het
Myo1c A T 11: 75,556,342 (GRCm39) probably null Het
Nek5 T C 8: 22,613,688 (GRCm39) probably benign Het
Nrxn2 A G 19: 6,540,728 (GRCm39) I894V possibly damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Pde4a C T 9: 21,103,717 (GRCm39) P175L probably damaging Het
Pip5k1c C A 10: 81,150,930 (GRCm39) A628E possibly damaging Het
Piwil2 C T 14: 70,660,080 (GRCm39) S139N probably benign Het
Prob1 T C 18: 35,786,092 (GRCm39) K721E possibly damaging Het
Rps6ka2 C A 17: 7,495,382 (GRCm39) S57Y probably damaging Het
Rxfp1 C T 3: 79,589,842 (GRCm39) V100M possibly damaging Het
Serpinb9e A T 13: 33,441,664 (GRCm39) M199L probably benign Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc4a8 G A 15: 100,682,761 (GRCm39) probably benign Het
Sned1 A T 1: 93,192,819 (GRCm39) S369C possibly damaging Het
St18 T A 1: 6,890,186 (GRCm39) F539L probably benign Het
Stam2 C T 2: 52,584,794 (GRCm39) G500D possibly damaging Het
Stx16 G A 2: 173,938,754 (GRCm39) V307M probably benign Het
Svep1 G A 4: 58,179,610 (GRCm39) S211L possibly damaging Het
Tcf12 C T 9: 71,765,904 (GRCm39) S512N probably benign Het
Tiam2 T C 17: 3,501,088 (GRCm39) V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 (GRCm39) A131V probably damaging Het
Tnrc6b C A 15: 80,778,556 (GRCm39) N1176K possibly damaging Het
Trrap C T 5: 144,741,045 (GRCm39) S1264L probably benign Het
Ttn T A 2: 76,640,775 (GRCm39) T13658S possibly damaging Het
Vmn2r104 G A 17: 20,249,889 (GRCm39) T794I probably damaging Het
Vmn2r52 T A 7: 9,904,982 (GRCm39) R286* probably null Het
Vps53 A T 11: 76,068,211 (GRCm39) probably benign Het
Wdr18 A G 10: 79,796,953 (GRCm39) probably benign Het
Zfp458 T A 13: 67,407,706 (GRCm39) K47* probably null Het
Zfp983 A G 17: 21,880,356 (GRCm39) T95A probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62,375,757 (GRCm39) missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62,374,074 (GRCm39) missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62,377,083 (GRCm39) missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62,372,149 (GRCm39) missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62,382,270 (GRCm39) missense possibly damaging 0.81
R0486:Wdr31 UTSW 4 62,372,130 (GRCm39) missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62,378,840 (GRCm39) missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62,374,180 (GRCm39) missense probably benign 0.00
R3620:Wdr31 UTSW 4 62,375,701 (GRCm39) missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62,375,675 (GRCm39) critical splice donor site probably null
R4303:Wdr31 UTSW 4 62,378,626 (GRCm39) missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62,372,159 (GRCm39) missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62,381,637 (GRCm39) missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62,374,113 (GRCm39) missense probably benign 0.02
R6170:Wdr31 UTSW 4 62,381,661 (GRCm39) missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62,375,802 (GRCm39) missense probably benign 0.03
R7126:Wdr31 UTSW 4 62,381,666 (GRCm39) missense probably benign 0.00
R7469:Wdr31 UTSW 4 62,375,768 (GRCm39) missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62,381,666 (GRCm39) missense probably benign 0.00
R7727:Wdr31 UTSW 4 62,378,873 (GRCm39) missense probably damaging 0.99
R8255:Wdr31 UTSW 4 62,381,634 (GRCm39) missense probably benign 0.00
R8704:Wdr31 UTSW 4 62,380,442 (GRCm39) missense probably benign
R9798:Wdr31 UTSW 4 62,381,651 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTACCAGGTTCCTGGAGACAGAC -3'
(R):5'- GAGCCATGTTCCACTCTGAAGTCC -3'

Sequencing Primer
(F):5'- GAGACAGACGCTCTCTCCAC -3'
(R):5'- AGCTTGTCCACTTGAGCTG -3'
Posted On 2013-05-09