Incidental Mutation 'R0257:Wdr31'
ID34777
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene NameWD repeat domain 31
Synonyms
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R0257 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62448653-62470896 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 62460518 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
Predicted Effect probably null
Transcript: ENSMUST00000030087
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000030087
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107452
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000107452
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120095
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000120095
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153615
Predicted Effect probably benign
Transcript: ENSMUST00000155522
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62457520 missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62455837 missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62458846 missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62453912 missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62464033 missense possibly damaging 0.81
R0486:Wdr31 UTSW 4 62453893 missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62460603 missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62455943 missense probably benign 0.00
R3620:Wdr31 UTSW 4 62457464 missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62457438 critical splice donor site probably null
R4303:Wdr31 UTSW 4 62460389 missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62453922 missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62463400 missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62455876 missense probably benign 0.02
R6170:Wdr31 UTSW 4 62463424 missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62457565 missense probably benign 0.03
R7126:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7469:Wdr31 UTSW 4 62457531 missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7727:Wdr31 UTSW 4 62460636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTACCAGGTTCCTGGAGACAGAC -3'
(R):5'- GAGCCATGTTCCACTCTGAAGTCC -3'

Sequencing Primer
(F):5'- GAGACAGACGCTCTCTCCAC -3'
(R):5'- AGCTTGTCCACTTGAGCTG -3'
Posted On2013-05-09