Incidental Mutation 'R0257:Disp3'
ID34778
Institutional Source Beutler Lab
Gene Symbol Disp3
Ensembl Gene ENSMUSG00000041544
Gene Namedispatched RND transporter family member 3
SynonymsPtchd2, G630052C06Rik
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0257 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148240264-148287965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 148250754 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 944 (N944K)
Ref Sequence ENSEMBL: ENSMUSP00000038490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047720]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047720
AA Change: N944K

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038490
Gene: ENSMUSG00000041544
AA Change: N944K

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
low complexity region 159 171 N/A INTRINSIC
low complexity region 179 195 N/A INTRINSIC
Pfam:Patched 362 735 2.2e-21 PFAM
Pfam:MMPL 366 590 3.1e-14 PFAM
Pfam:Sterol-sensing 435 588 1.1e-17 PFAM
Pfam:Patched 1121 1301 1.6e-7 PFAM
transmembrane domain 1314 1333 N/A INTRINSIC
Meta Mutation Damage Score 0.1475 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Disp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Disp3 APN 4 148241534 missense probably benign 0.10
IGL01065:Disp3 APN 4 148261183 missense probably damaging 1.00
IGL01800:Disp3 APN 4 148249801 nonsense probably null
IGL01947:Disp3 APN 4 148260519 missense probably damaging 1.00
IGL02510:Disp3 APN 4 148252701 missense probably benign 0.00
IGL02573:Disp3 APN 4 148271449 missense probably damaging 1.00
IGL02728:Disp3 APN 4 148272038 missense probably damaging 1.00
IGL02931:Disp3 APN 4 148249201 missense possibly damaging 0.94
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0164:Disp3 UTSW 4 148254251 missense probably damaging 0.96
R0409:Disp3 UTSW 4 148271959 missense probably damaging 1.00
R0557:Disp3 UTSW 4 148241404 missense possibly damaging 0.64
R0576:Disp3 UTSW 4 148241590 missense possibly damaging 0.89
R1495:Disp3 UTSW 4 148249825 missense probably benign 0.00
R1526:Disp3 UTSW 4 148259916 missense probably benign 0.00
R1791:Disp3 UTSW 4 148241518 missense probably damaging 1.00
R1856:Disp3 UTSW 4 148271632 missense probably damaging 1.00
R1987:Disp3 UTSW 4 148258753 missense probably damaging 0.97
R2030:Disp3 UTSW 4 148259966 missense probably damaging 1.00
R2271:Disp3 UTSW 4 148271602 missense possibly damaging 0.87
R2373:Disp3 UTSW 4 148258795 missense probably damaging 1.00
R2566:Disp3 UTSW 4 148241423 missense probably damaging 1.00
R3731:Disp3 UTSW 4 148252827 missense probably benign 0.03
R4359:Disp3 UTSW 4 148271932 missense probably benign 0.03
R4762:Disp3 UTSW 4 148272118 missense probably damaging 1.00
R4950:Disp3 UTSW 4 148258126 missense possibly damaging 0.94
R4975:Disp3 UTSW 4 148244216 missense possibly damaging 0.79
R5218:Disp3 UTSW 4 148242876 missense possibly damaging 0.88
R5523:Disp3 UTSW 4 148258097 missense probably benign 0.14
R5556:Disp3 UTSW 4 148258157 missense probably benign 0.14
R5857:Disp3 UTSW 4 148249183 missense probably benign 0.01
R5933:Disp3 UTSW 4 148241313 nonsense probably null
R5994:Disp3 UTSW 4 148254284 missense possibly damaging 0.94
R6362:Disp3 UTSW 4 148254308 missense possibly damaging 0.95
R6813:Disp3 UTSW 4 148259930 missense probably benign 0.09
R7211:Disp3 UTSW 4 148241522 missense probably damaging 0.98
R7470:Disp3 UTSW 4 148261070 missense possibly damaging 0.88
R7535:Disp3 UTSW 4 148242866 missense probably damaging 0.99
Z1088:Disp3 UTSW 4 148271743 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- AGCTGTGTGACCTTTCACATCTGC -3'
(R):5'- ACTTTGCTCAGTCCCACAAGCC -3'

Sequencing Primer
(F):5'- CTTTCACATCTGCCCAAAGTG -3'
(R):5'- TCAGCTCCAGCCCTGATG -3'
Posted On2013-05-09