Incidental Mutation 'R0257:C3ar1'
ID34780
Institutional Source Beutler Lab
Gene Symbol C3ar1
Ensembl Gene ENSMUSG00000040552
Gene Namecomplement component 3a receptor 1
SynonymsC3aR, anaphylatoxin C3a receptor
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0257 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location122847138-122856161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122850787 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 157 (V157A)
Ref Sequence ENSEMBL: ENSMUSP00000048092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042081]
Predicted Effect probably benign
Transcript: ENSMUST00000042081
AA Change: V157A

PolyPhen 2 Score 0.247 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048092
Gene: ENSMUSG00000040552
AA Change: V157A

DomainStartEndE-ValueType
Pfam:7tm_1 40 193 8.1e-25 PFAM
Pfam:7TM_GPCR_Srsx 281 443 7.8e-8 PFAM
Pfam:7tm_1 313 428 6.5e-17 PFAM
Meta Mutation Damage Score 0.1573 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C3a is an anaphylatoxin released during activation of the complement system. The protein encoded by this gene is an orphan G protein-coupled receptor for C3a. Binding of C3a by the encoded receptor activates chemotaxis, granule enzyme release, superoxide anion production, and bacterial opsonization. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous targeted mutants display protective effects against the changes in lung physiology after allergen challenge, increased lethality to endotoxin shock, and elevated IL1B following LPS challenge, supporting the role of C3arin proinflammatory responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in C3ar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01818:C3ar1 APN 6 122850419 missense probably benign 0.00
IGL01936:C3ar1 APN 6 122851235 missense probably benign 0.04
IGL01998:C3ar1 APN 6 122850940 missense probably damaging 1.00
IGL02351:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02358:C3ar1 APN 6 122849975 missense probably damaging 1.00
IGL02399:C3ar1 APN 6 122849879 missense probably benign 0.00
PIT4618001:C3ar1 UTSW 6 122850787 missense probably benign 0.25
R0014:C3ar1 UTSW 6 122850851 missense probably damaging 1.00
R0195:C3ar1 UTSW 6 122851155 missense possibly damaging 0.95
R0344:C3ar1 UTSW 6 122850772 missense probably benign 0.45
R4345:C3ar1 UTSW 6 122850700 missense probably damaging 1.00
R4614:C3ar1 UTSW 6 122850721 missense probably benign 0.00
R4643:C3ar1 UTSW 6 122850974 missense probably damaging 1.00
R4840:C3ar1 UTSW 6 122850764 missense probably benign
R5235:C3ar1 UTSW 6 122850922 missense probably damaging 1.00
R5303:C3ar1 UTSW 6 122849835 missense probably damaging 1.00
R5610:C3ar1 UTSW 6 122850578 missense probably benign 0.01
R5762:C3ar1 UTSW 6 122850362 missense probably benign 0.07
R5873:C3ar1 UTSW 6 122850422 missense probably benign 0.24
R5877:C3ar1 UTSW 6 122850622 missense probably benign 0.17
R6327:C3ar1 UTSW 6 122850146 missense probably damaging 1.00
R6440:C3ar1 UTSW 6 122850508 missense probably damaging 0.99
R6505:C3ar1 UTSW 6 122850640 missense probably benign 0.03
R6636:C3ar1 UTSW 6 122851054 missense probably damaging 1.00
R6755:C3ar1 UTSW 6 122849858 missense probably benign 0.00
R6953:C3ar1 UTSW 6 122850632 missense possibly damaging 0.49
R8049:C3ar1 UTSW 6 122850100 missense not run
X0065:C3ar1 UTSW 6 122850765 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAGGAAGGAGCTGACCTGTCATTC -3'
(R):5'- GCTCACCTGATTCTCCAAGGACAC -3'

Sequencing Primer
(F):5'- GACCTGTCATTCATATGTCCAGTTAG -3'
(R):5'- ATGGCTTGTTCCTGTGCAAAC -3'
Posted On2013-05-09