Incidental Mutation 'R0257:Ano2'
ID34781
Institutional Source Beutler Lab
Gene Symbol Ano2
Ensembl Gene ENSMUSG00000038115
Gene Nameanoctamin 2
SynonymsTmem16b
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R0257 (G1)
Quality Score182
Status Validated
Chromosome6
Chromosomal Location125690419-126040126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 125880713 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 505 (A505E)
Ref Sequence ENSEMBL: ENSMUSP00000125303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159984] [ENSMUST00000160496]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158334
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159111
Predicted Effect probably benign
Transcript: ENSMUST00000159984
AA Change: A171E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000123965
Gene: ENSMUSG00000038115
AA Change: A171E

DomainStartEndE-ValueType
Pfam:Anoctamin 21 181 1.7e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160317
Predicted Effect probably benign
Transcript: ENSMUST00000160496
AA Change: A505E

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000125303
Gene: ENSMUSG00000038115
AA Change: A505E

DomainStartEndE-ValueType
low complexity region 60 69 N/A INTRINSIC
Pfam:Anoct_dimer 91 348 5.7e-78 PFAM
Pfam:Anoctamin 351 941 6.7e-138 PFAM
low complexity region 964 991 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000161619
AA Change: A474E
SMART Domains Protein: ENSMUSP00000125426
Gene: ENSMUSG00000038115
AA Change: A474E

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:Anoctamin 262 425 1.9e-39 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ANO2 belongs to a family of calcium-activated chloride channels (CaCCs) (reviewed by Hartzell et al., 2009 [PubMed 19015192]).[supplied by OMIM, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele lack calcium-activated chloride currents in the main olfactory epithelium and vomeronasal organ but normal olfaction in behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Ano2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Ano2 APN 6 126013253 missense probably damaging 1.00
IGL01387:Ano2 APN 6 126013277 missense probably damaging 0.99
IGL01772:Ano2 APN 6 126036858 missense probably damaging 0.98
IGL01931:Ano2 APN 6 125982745 missense probably damaging 1.00
IGL02066:Ano2 APN 6 125690739 missense probably benign 0.07
IGL02410:Ano2 APN 6 125815533 critical splice acceptor site probably null
IGL02526:Ano2 APN 6 125872751 critical splice donor site probably null
IGL03116:Ano2 APN 6 125980171 nonsense probably null
IGL03183:Ano2 APN 6 125710629 missense probably benign
IGL03391:Ano2 APN 6 125807839 missense probably damaging 1.00
R0462:Ano2 UTSW 6 125712275 missense probably benign 0.26
R0594:Ano2 UTSW 6 125982765 missense probably damaging 1.00
R1072:Ano2 UTSW 6 126039324 missense probably damaging 1.00
R1099:Ano2 UTSW 6 125807847 missense probably damaging 1.00
R1436:Ano2 UTSW 6 125867171 critical splice donor site probably null
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1468:Ano2 UTSW 6 125796264 missense probably damaging 1.00
R1822:Ano2 UTSW 6 125863457 missense probably damaging 1.00
R1901:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1902:Ano2 UTSW 6 125872684 missense probably damaging 1.00
R1911:Ano2 UTSW 6 126013691 missense probably benign 0.00
R2040:Ano2 UTSW 6 126039508 missense probably benign 0.13
R2192:Ano2 UTSW 6 126015539 missense probably damaging 1.00
R2307:Ano2 UTSW 6 125992886 missense probably benign 0.00
R2698:Ano2 UTSW 6 125712346 missense probably benign 0.01
R2878:Ano2 UTSW 6 125863518 missense probably damaging 1.00
R3151:Ano2 UTSW 6 126013317 splice site probably null
R4004:Ano2 UTSW 6 126013279 missense probably damaging 1.00
R4664:Ano2 UTSW 6 125863538 missense probably benign 0.07
R4684:Ano2 UTSW 6 125790341 missense probably benign 0.00
R4685:Ano2 UTSW 6 125980124 nonsense probably null
R4686:Ano2 UTSW 6 125790291 missense probably benign 0.10
R4852:Ano2 UTSW 6 125982923 missense possibly damaging 0.95
R4923:Ano2 UTSW 6 125903055 utr 3 prime probably benign
R5488:Ano2 UTSW 6 126039253 missense possibly damaging 0.46
R5513:Ano2 UTSW 6 126039322 missense possibly damaging 0.88
R5699:Ano2 UTSW 6 125872740 missense probably damaging 1.00
R5876:Ano2 UTSW 6 126039279 missense possibly damaging 0.92
R6175:Ano2 UTSW 6 125992955 missense probably benign 0.15
R6219:Ano2 UTSW 6 125815590 missense probably damaging 1.00
R6613:Ano2 UTSW 6 125806656 splice site probably null
R6711:Ano2 UTSW 6 125775832 missense probably damaging 1.00
R6982:Ano2 UTSW 6 125992893 missense probably benign
R7153:Ano2 UTSW 6 125992943 missense possibly damaging 0.73
R7182:Ano2 UTSW 6 125790293 missense probably damaging 0.99
R7312:Ano2 UTSW 6 126039497 nonsense probably null
R7358:Ano2 UTSW 6 125710733 missense probably benign
R7456:Ano2 UTSW 6 125963545 missense probably benign 0.01
R7532:Ano2 UTSW 6 125963704 missense probably damaging 1.00
R7607:Ano2 UTSW 6 125712419 missense probably damaging 1.00
R7623:Ano2 UTSW 6 126015573 nonsense probably null
R7690:Ano2 UTSW 6 126013198 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCTCACAACATTGTGTCCTTGC -3'
(R):5'- ACTTGCCATGACAGCCTGTTCC -3'

Sequencing Primer
(F):5'- TGATAGTGTCCATTCCTAAACCCAG -3'
(R):5'- ATGACAGCCTGTTCCCAAGG -3'
Posted On2013-05-09