Incidental Mutation 'R0257:Olfr372'
ID34785
Institutional Source Beutler Lab
Gene Symbol Olfr372
Ensembl Gene ENSMUSG00000069998
Gene Nameolfactory receptor 372
SynonymsGA_x6K02T2NUPS-191522-192466, MOR282-1
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0257 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72041218-72060630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72058400 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 240 (T240M)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
Predicted Effect probably damaging
Transcript: ENSMUST00000093434
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: T240M

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215324
AA Change: T240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Olfr372
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Olfr372 APN 8 72058076 missense probably damaging 1.00
R0126:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0128:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0130:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0132:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0152:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0230:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0244:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0256:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0294:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0316:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0318:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0391:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0479:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0604:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0624:Olfr372 UTSW 8 72058162 missense possibly damaging 0.94
R0631:Olfr372 UTSW 8 72058322 missense probably damaging 0.99
R1785:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R1786:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R2040:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
R4176:Olfr372 UTSW 8 72058184 missense probably damaging 1.00
R4782:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R4799:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R6915:Olfr372 UTSW 8 72057730 missense probably benign 0.19
R7512:Olfr372 UTSW 8 72058523 missense probably damaging 1.00
R8255:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
RF022:Olfr372 UTSW 8 72058624 makesense probably null
Predicted Primers PCR Primer
(F):5'- CTGTCATGTGCAGACACATCAGCC -3'
(R):5'- GGATCGAAGGACATCATCGCTTCAC -3'

Sequencing Primer
(F):5'- ACATCAGCCTATGAGTTGGCG -3'
(R):5'- CAAGGACATTCGAACTTCTCTG -3'
Posted On2013-05-09