Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Adgre5'

34786

Institutional Source

Beutler Lab

Gene Symbol

Adgre5

Ensembl Gene

ENSMUSG00000002885

Gene Name

adhesion G protein-coupled receptor E5

Synonyms

Cd97, EGF-TM7 receptor

MMRRC Submission

038488-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0257 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

83723251-83741326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83731995 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 134 (H134L)

Ref Sequence

ENSEMBL: ENSMUSP00000075240 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002964] [ENSMUST00000075843] [ENSMUST00000109802] [ENSMUST00000149368] [ENSMUST00000166939]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000002964

SMART Domains

Protein: ENSMUSP00000002964
Gene: ENSMUSG00000002885

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	120	167	1.78e-11	SMART
GPS	384	430	2.18e-8	SMART
Pfam:Dicty_CAR	431	703	1.3e-8	PFAM
Pfam:7tm_2	432	672	8.1e-68	PFAM
low complexity region	704	714	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075843
AA Change: H134L

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000075240
Gene: ENSMUSG00000002885
AA Change: H134L

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	165	213	1.38e-8	SMART
EGF_CA	214	261	1.78e-11	SMART
GPS	478	524	2.18e-8	SMART
Pfam:Dicty_CAR	525	798	4.6e-8	PFAM
Pfam:7tm_2	526	766	5.3e-68	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109802

SMART Domains

Protein: ENSMUSP00000105427
Gene: ENSMUSG00000002885

Domain	Start	End	E-Value	Type
EGF	30	68	1.63e1	SMART
EGF_CA	69	119	5.92e-8	SMART
EGF_CA	120	168	1.38e-8	SMART
EGF_CA	169	216	1.78e-11	SMART
GPS	433	479	2.18e-8	SMART
Pfam:Dicty_CAR	480	752	5.3e-8	PFAM
Pfam:7tm_2	481	721	7.5e-67	PFAM
low complexity region	753	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140606

Predicted Effect

probably benign
Transcript: ENSMUST00000149368

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154075

Predicted Effect

probably benign
Transcript: ENSMUST00000166939

SMART Domains

Protein: ENSMUSP00000128220
Gene: ENSMUSG00000002885

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
EGF	28	66	1.63e1	SMART
EGF_CA	67	117	5.92e-8	SMART
EGF_CA	118	165	1.78e-11	SMART
GPS	382	428	2.18e-8	SMART
Pfam:Dicty_CAR	429	701	2.1e-7	PFAM
Pfam:7tm_2	430	670	1.7e-66	PFAM
low complexity region	702	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EGF-TM7 subfamily of adhesion G protein-coupled receptors, which mediate cell-cell interactions. These proteins are cleaved by self-catalytic proteolysis into a large extracellular subunit and seven-span transmembrane subunit, which associate at the cell surface as a receptor complex. The encoded protein may play a role in cell adhesion as well as leukocyte recruitment, activation and migration, and contains multiple extracellular EGF-like repeats which mediate binding to chondroitin sulfate and the cell surface complement regulatory protein CD55. Expression of this gene may play a role in the progression of several types of cancer. Alternatively spliced transcript variants encoding multiple isoforms with 3 to 5 EGF-like repeats have been observed for this gene. This gene is found in a cluster with other EGF-TM7 genes on the short arm of chromosome 19. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype apart from mild granulocytosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Adgre5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Adgre5	APN	8	83728401	missense	probably benign	0.01
IGL01365:Adgre5	APN	8	83723889	splice site	probably null
IGL01661:Adgre5	APN	8	83727935	missense	probably damaging	0.99
IGL01707:Adgre5	APN	8	83724347	missense	probably damaging	1.00
IGL01760:Adgre5	APN	8	83731957	missense	probably benign	0.02
IGL02207:Adgre5	APN	8	83728284	missense	probably damaging	1.00
IGL02483:Adgre5	APN	8	83725253	missense	probably damaging	1.00
IGL03194:Adgre5	APN	8	83734018	missense	possibly damaging	0.67
BB001:Adgre5	UTSW	8	83729400	missense	possibly damaging	0.85
BB011:Adgre5	UTSW	8	83729400	missense	possibly damaging	0.85
PIT4453001:Adgre5	UTSW	8	83724460	missense	probably benign	0.08
R0024:Adgre5	UTSW	8	83728284	missense	probably damaging	1.00
R0137:Adgre5	UTSW	8	83724898	missense	probably damaging	1.00
R0485:Adgre5	UTSW	8	83731998	missense	probably damaging	0.99
R0522:Adgre5	UTSW	8	83730176	missense	probably benign	0.30
R0940:Adgre5	UTSW	8	83733497	missense	probably damaging	1.00
R1372:Adgre5	UTSW	8	83728320	missense	probably damaging	0.96
R1617:Adgre5	UTSW	8	83730177	missense	possibly damaging	0.50
R1679:Adgre5	UTSW	8	83729405	missense	probably benign	0.09
R1917:Adgre5	UTSW	8	83729109	missense	probably damaging	0.99
R1918:Adgre5	UTSW	8	83729109	missense	probably damaging	0.99
R2072:Adgre5	UTSW	8	83727804	missense	probably benign	0.24
R2831:Adgre5	UTSW	8	83728394	missense	possibly damaging	0.80
R5250:Adgre5	UTSW	8	83733440	missense	probably benign
R5512:Adgre5	UTSW	8	83729086	missense	probably benign
R6077:Adgre5	UTSW	8	83727966	missense	probably benign
R7486:Adgre5	UTSW	8	83723886	missense	probably damaging	1.00
R7733:Adgre5	UTSW	8	83729396	missense	probably benign	0.06
R7924:Adgre5	UTSW	8	83729400	missense	possibly damaging	0.85
R8388:Adgre5	UTSW	8	83730186	missense	probably damaging	1.00
R9138:Adgre5	UTSW	8	83725934	missense	probably benign	0.29
R9625:Adgre5	UTSW	8	83724029	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGAATTGCTGGGGATAGTCAGAACC -3'
(R):5'- CATCTGCATCTCATTTGCATAAGCCAC -3'

Sequencing Primer
(F):5'- GAGCAATGGACAAGGCTCTG -3'
(R):5'- TGCATAAGCCACTATCCTTCTG -3'

Posted On

2013-05-09