Incidental Mutation 'R0257:Pde4a'
ID34788
Institutional Source Beutler Lab
Gene Symbol Pde4a
Ensembl Gene ENSMUSG00000032177
Gene Namephosphodiesterase 4A, cAMP specific
SynonymsDpde2, dunce, D9Ertd60e
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R0257 (G1)
Quality Score213
Status Validated
Chromosome9
Chromosomal Location21165714-21213248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 21192421 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 175 (P175L)
Ref Sequence ENSEMBL: ENSMUSP00000037025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003395] [ENSMUST00000039413] [ENSMUST00000115458]
Predicted Effect probably benign
Transcript: ENSMUST00000003395
SMART Domains Protein: ENSMUSP00000003395
Gene: ENSMUSG00000032177

DomainStartEndE-ValueType
low complexity region 62 87 N/A INTRINSIC
HDc 182 357 7.12e-5 SMART
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000039413
AA Change: P175L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037025
Gene: ENSMUSG00000032177
AA Change: P175L

DomainStartEndE-ValueType
low complexity region 35 46 N/A INTRINSIC
low complexity region 92 102 N/A INTRINSIC
low complexity region 296 321 N/A INTRINSIC
HDc 416 591 7.12e-5 SMART
low complexity region 696 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115458
AA Change: P118L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000111118
Gene: ENSMUSG00000032177
AA Change: P118L

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
HDc 359 534 7.12e-5 SMART
low complexity region 639 652 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140440
Meta Mutation Damage Score 0.4583 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE4 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous null mice have a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Pde4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pde4a APN 9 21211061 missense probably benign 0.01
IGL01330:Pde4a APN 9 21192438 splice site probably benign
IGL01403:Pde4a APN 9 21205116 missense probably damaging 1.00
IGL01610:Pde4a APN 9 21211350 utr 3 prime probably benign
IGL02010:Pde4a APN 9 21203554 critical splice donor site probably null
IGL02296:Pde4a APN 9 21192569 missense possibly damaging 0.94
IGL02637:Pde4a APN 9 21201332 missense probably damaging 0.97
PIT4696001:Pde4a UTSW 9 21211001 missense probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0032:Pde4a UTSW 9 21201432 splice site probably benign
R0504:Pde4a UTSW 9 21204403 missense probably damaging 1.00
R1437:Pde4a UTSW 9 21192592 critical splice donor site probably null
R1524:Pde4a UTSW 9 21201247 missense probably damaging 0.98
R1750:Pde4a UTSW 9 21203232 missense probably damaging 1.00
R2239:Pde4a UTSW 9 21211268 missense probably damaging 1.00
R2905:Pde4a UTSW 9 21201349 missense probably benign 0.01
R2991:Pde4a UTSW 9 21203243 missense probably damaging 0.96
R3972:Pde4a UTSW 9 21206217 missense probably damaging 1.00
R4826:Pde4a UTSW 9 21192380 splice site probably null
R4922:Pde4a UTSW 9 21210713 missense probably damaging 1.00
R5195:Pde4a UTSW 9 21204333 missense possibly damaging 0.70
R5208:Pde4a UTSW 9 21203558 splice site probably null
R5552:Pde4a UTSW 9 21201386 missense probably damaging 1.00
R5713:Pde4a UTSW 9 21203517 missense probably damaging 1.00
R6722:Pde4a UTSW 9 21211225 missense probably damaging 1.00
R6792:Pde4a UTSW 9 21192590 missense probably benign 0.03
R6861:Pde4a UTSW 9 21205301 missense probably damaging 1.00
R6901:Pde4a UTSW 9 21204970 missense probably benign 0.37
R7300:Pde4a UTSW 9 21206322 missense probably damaging 1.00
R7690:Pde4a UTSW 9 21166004 missense probably damaging 1.00
R7798:Pde4a UTSW 9 21198663 missense possibly damaging 0.63
R8073:Pde4a UTSW 9 21210769 missense probably damaging 1.00
R8133:Pde4a UTSW 9 21191377 missense possibly damaging 0.87
R8167:Pde4a UTSW 9 21206173 missense possibly damaging 0.95
R8297:Pde4a UTSW 9 21166108 missense possibly damaging 0.94
R8348:Pde4a UTSW 9 21206238 missense probably benign 0.35
R8448:Pde4a UTSW 9 21206238 missense probably benign 0.35
X0027:Pde4a UTSW 9 21198654 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTATAAGCCCTACAGGGTGGGAGC -3'
(R):5'- CACCACTTACTTGTTGCTGGGGATG -3'

Sequencing Primer
(F):5'- TGGGAGCCCCAACTACTTG -3'
(R):5'- ATGGGCACATTGGTTAGGAG -3'
Posted On2013-05-09