Incidental Mutation 'R0257:Fgd6'
ID 34791
Institutional Source Beutler Lab
Gene Symbol Fgd6
Ensembl Gene ENSMUSG00000020021
Gene Name FYVE, RhoGEF and PH domain containing 6
Synonyms Etohd4, ZFYVE24
MMRRC Submission 038488-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R0257 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 93871863-93981201 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 93879777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 210 (H210Q)
Ref Sequence ENSEMBL: ENSMUSP00000020208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020208]
AlphaFold Q69ZL1
PDB Structure Solution Structure of the Pleckstrin Homology Domain of Mouse Ethanol Decreased 4 Protein [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020208
AA Change: H210Q

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000020208
Gene: ENSMUSG00000020021
AA Change: H210Q

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 24 34 N/A INTRINSIC
low complexity region 45 60 N/A INTRINSIC
low complexity region 75 88 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
low complexity region 803 821 N/A INTRINSIC
RhoGEF 845 1029 3.09e-46 SMART
PH 1060 1155 6.25e-15 SMART
FYVE 1183 1251 6.93e-28 SMART
low complexity region 1268 1282 N/A INTRINSIC
PH 1303 1398 1.54e-5 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T A 11: 84,401,107 (GRCm39) E171D probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adgre5 T A 8: 84,458,624 (GRCm39) H134L possibly damaging Het
Ahsg A T 16: 22,717,790 (GRCm39) M256L probably benign Het
Alk A T 17: 72,910,490 (GRCm39) L72Q probably damaging Het
Ano2 C A 6: 125,857,676 (GRCm39) A505E probably benign Het
Bcas3 A G 11: 85,712,865 (GRCm39) K908E probably benign Het
C3ar1 A G 6: 122,827,746 (GRCm39) V157A probably benign Het
Car2 C G 3: 14,965,037 (GRCm39) H224D probably benign Het
Cfh T C 1: 140,071,773 (GRCm39) D287G probably benign Het
Disp3 G T 4: 148,335,211 (GRCm39) N944K possibly damaging Het
Dlg1 A G 16: 31,661,671 (GRCm39) probably benign Het
Dmbt1 A G 7: 130,708,123 (GRCm39) E1281G probably damaging Het
Dmxl1 T A 18: 50,088,870 (GRCm39) probably benign Het
Dtx3 T C 10: 127,028,761 (GRCm39) D159G probably benign Het
Ets2 T A 16: 95,513,245 (GRCm39) C140* probably null Het
Fbf1 T C 11: 116,045,917 (GRCm39) I226V probably benign Het
Fktn A G 4: 53,734,898 (GRCm39) T179A probably benign Het
Galnt10 T C 11: 57,671,904 (GRCm39) M398T probably damaging Het
Grk5 G T 19: 61,065,068 (GRCm39) probably benign Het
Gse1 A G 8: 121,299,073 (GRCm39) probably benign Het
Hmcn2 T C 2: 31,259,176 (GRCm39) probably benign Het
Iqgap2 A G 13: 95,861,052 (GRCm39) probably null Het
Lama4 T C 10: 38,970,880 (GRCm39) probably benign Het
Luzp2 A G 7: 54,899,194 (GRCm39) T271A probably benign Het
Mdn1 T A 4: 32,693,534 (GRCm39) V1053D probably damaging Het
Mrm1 A C 11: 84,705,649 (GRCm39) probably benign Het
Msh5 G C 17: 35,251,840 (GRCm39) R407G probably damaging Het
Myo1c A T 11: 75,556,342 (GRCm39) probably null Het
Nek5 T C 8: 22,613,688 (GRCm39) probably benign Het
Nrxn2 A G 19: 6,540,728 (GRCm39) I894V possibly damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Pde4a C T 9: 21,103,717 (GRCm39) P175L probably damaging Het
Pip5k1c C A 10: 81,150,930 (GRCm39) A628E possibly damaging Het
Piwil2 C T 14: 70,660,080 (GRCm39) S139N probably benign Het
Prob1 T C 18: 35,786,092 (GRCm39) K721E possibly damaging Het
Rps6ka2 C A 17: 7,495,382 (GRCm39) S57Y probably damaging Het
Rxfp1 C T 3: 79,589,842 (GRCm39) V100M possibly damaging Het
Serpinb9e A T 13: 33,441,664 (GRCm39) M199L probably benign Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc4a8 G A 15: 100,682,761 (GRCm39) probably benign Het
Sned1 A T 1: 93,192,819 (GRCm39) S369C possibly damaging Het
St18 T A 1: 6,890,186 (GRCm39) F539L probably benign Het
Stam2 C T 2: 52,584,794 (GRCm39) G500D possibly damaging Het
Stx16 G A 2: 173,938,754 (GRCm39) V307M probably benign Het
Svep1 G A 4: 58,179,610 (GRCm39) S211L possibly damaging Het
Tcf12 C T 9: 71,765,904 (GRCm39) S512N probably benign Het
Tiam2 T C 17: 3,501,088 (GRCm39) V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 (GRCm39) A131V probably damaging Het
Tnrc6b C A 15: 80,778,556 (GRCm39) N1176K possibly damaging Het
Trrap C T 5: 144,741,045 (GRCm39) S1264L probably benign Het
Ttn T A 2: 76,640,775 (GRCm39) T13658S possibly damaging Het
Vmn2r104 G A 17: 20,249,889 (GRCm39) T794I probably damaging Het
Vmn2r52 T A 7: 9,904,982 (GRCm39) R286* probably null Het
Vps53 A T 11: 76,068,211 (GRCm39) probably benign Het
Wdr18 A G 10: 79,796,953 (GRCm39) probably benign Het
Wdr31 A G 4: 62,378,755 (GRCm39) probably null Het
Zfp458 T A 13: 67,407,706 (GRCm39) K47* probably null Het
Zfp983 A G 17: 21,880,356 (GRCm39) T95A probably benign Het
Other mutations in Fgd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Fgd6 APN 10 93,879,496 (GRCm39) missense probably benign 0.01
IGL00975:Fgd6 APN 10 93,969,938 (GRCm39) missense probably damaging 0.98
IGL01366:Fgd6 APN 10 93,879,338 (GRCm39) missense possibly damaging 0.71
IGL01940:Fgd6 APN 10 93,925,512 (GRCm39) splice site probably null
IGL01958:Fgd6 APN 10 93,974,170 (GRCm39) missense probably benign 0.25
IGL01988:Fgd6 APN 10 93,910,197 (GRCm39) splice site probably benign
IGL02019:Fgd6 APN 10 93,969,216 (GRCm39) missense probably damaging 1.00
IGL02074:Fgd6 APN 10 93,963,297 (GRCm39) missense probably damaging 1.00
IGL02227:Fgd6 APN 10 93,969,946 (GRCm39) missense probably damaging 1.00
IGL02262:Fgd6 APN 10 93,961,490 (GRCm39) missense probably damaging 0.98
IGL02353:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02360:Fgd6 APN 10 93,974,258 (GRCm39) missense possibly damaging 0.82
IGL02425:Fgd6 APN 10 93,910,064 (GRCm39) missense probably benign 0.00
IGL02526:Fgd6 APN 10 93,936,373 (GRCm39) missense probably benign 0.21
IGL02607:Fgd6 APN 10 93,880,310 (GRCm39) missense possibly damaging 0.94
IGL02741:Fgd6 APN 10 93,959,152 (GRCm39) missense possibly damaging 0.65
IGL02870:Fgd6 APN 10 93,881,026 (GRCm39) missense probably damaging 1.00
IGL02884:Fgd6 APN 10 93,881,501 (GRCm39) splice site probably benign
IGL02995:Fgd6 APN 10 93,881,342 (GRCm39) nonsense probably null
IGL03189:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
IGL03258:Fgd6 APN 10 93,969,215 (GRCm39) missense probably benign 0.44
IGL03396:Fgd6 APN 10 93,880,318 (GRCm39) missense probably benign 0.26
FR4449:Fgd6 UTSW 10 93,880,182 (GRCm39) small deletion probably benign
R0926:Fgd6 UTSW 10 93,970,909 (GRCm39) missense probably benign 0.40
R1325:Fgd6 UTSW 10 93,963,289 (GRCm39) missense probably damaging 1.00
R1422:Fgd6 UTSW 10 93,881,234 (GRCm39) missense probably damaging 1.00
R1491:Fgd6 UTSW 10 93,880,694 (GRCm39) missense probably benign 0.06
R1593:Fgd6 UTSW 10 93,880,894 (GRCm39) missense probably damaging 1.00
R1624:Fgd6 UTSW 10 93,973,298 (GRCm39) missense probably benign 0.19
R1929:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.01
R2064:Fgd6 UTSW 10 93,880,903 (GRCm39) missense probably damaging 0.98
R2965:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R2966:Fgd6 UTSW 10 93,880,056 (GRCm39) missense probably benign 0.03
R3889:Fgd6 UTSW 10 93,925,499 (GRCm39) missense probably damaging 1.00
R4094:Fgd6 UTSW 10 93,879,296 (GRCm39) missense probably damaging 1.00
R4605:Fgd6 UTSW 10 93,880,217 (GRCm39) missense probably benign 0.12
R4883:Fgd6 UTSW 10 93,975,715 (GRCm39) missense probably benign 0.00
R5217:Fgd6 UTSW 10 93,969,939 (GRCm39) missense possibly damaging 0.90
R5473:Fgd6 UTSW 10 93,880,538 (GRCm39) missense probably benign 0.00
R5606:Fgd6 UTSW 10 93,974,190 (GRCm39) nonsense probably null
R5644:Fgd6 UTSW 10 93,969,912 (GRCm39) missense possibly damaging 0.80
R6051:Fgd6 UTSW 10 93,973,427 (GRCm39) critical splice donor site probably null
R6258:Fgd6 UTSW 10 93,880,161 (GRCm39) missense probably benign 0.00
R6735:Fgd6 UTSW 10 93,910,182 (GRCm39) missense possibly damaging 0.94
R7181:Fgd6 UTSW 10 93,879,373 (GRCm39) missense probably benign 0.02
R7210:Fgd6 UTSW 10 93,969,954 (GRCm39) missense probably damaging 0.98
R7296:Fgd6 UTSW 10 93,975,743 (GRCm39) missense probably benign 0.02
R7296:Fgd6 UTSW 10 93,879,909 (GRCm39) nonsense probably null
R7697:Fgd6 UTSW 10 93,881,306 (GRCm39) missense probably damaging 0.99
R7747:Fgd6 UTSW 10 93,880,778 (GRCm39) missense probably damaging 1.00
R7861:Fgd6 UTSW 10 93,939,193 (GRCm39) missense probably benign 0.15
R7940:Fgd6 UTSW 10 93,956,344 (GRCm39) missense probably benign 0.02
R8022:Fgd6 UTSW 10 93,880,206 (GRCm39) missense possibly damaging 0.54
R8138:Fgd6 UTSW 10 93,970,005 (GRCm39) missense probably null 0.45
R8171:Fgd6 UTSW 10 93,910,194 (GRCm39) critical splice donor site probably null
R8189:Fgd6 UTSW 10 93,910,077 (GRCm39) missense probably benign 0.00
R8213:Fgd6 UTSW 10 93,879,914 (GRCm39) missense probably benign 0.37
R8960:Fgd6 UTSW 10 93,880,868 (GRCm39) missense probably benign 0.06
R8981:Fgd6 UTSW 10 93,880,916 (GRCm39) missense possibly damaging 0.80
R8989:Fgd6 UTSW 10 93,959,425 (GRCm39) missense probably damaging 0.97
R9609:Fgd6 UTSW 10 93,879,674 (GRCm39) missense probably damaging 0.99
RF031:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
RF040:Fgd6 UTSW 10 93,880,187 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTCAAGCAGCGAAAAGTGCCG -3'
(R):5'- AAGGACCGAGACCTTTGACCTCTG -3'

Sequencing Primer
(F):5'- AAAAGTGCCGGGGCCAG -3'
(R):5'- CCGGTTCACATGAATCAGTG -3'
Posted On 2013-05-09