Incidental Mutation 'R0257:Vps53'
ID34794
Institutional Source Beutler Lab
Gene Symbol Vps53
Ensembl Gene ENSMUSG00000017288
Gene NameVPS53 GARP complex subunit
Synonyms2310040I21Rik, 3100002B05Rik, 2010002A08Rik
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0257 (G1)
Quality Score127
Status Validated
Chromosome11
Chromosomal Location76046226-76179647 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 76177385 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056601] [ENSMUST00000094015] [ENSMUST00000108419] [ENSMUST00000129256] [ENSMUST00000129853] [ENSMUST00000163878] [ENSMUST00000166752] [ENSMUST00000167114] [ENSMUST00000169734] [ENSMUST00000170730]
Predicted Effect probably benign
Transcript: ENSMUST00000056601
SMART Domains Protein: ENSMUSP00000061317
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 5.9e-11 PFAM
Pfam:Vps53_N 39 453 1.9e-176 PFAM
low complexity region 520 533 N/A INTRINSIC
low complexity region 820 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094015
SMART Domains Protein: ENSMUSP00000091554
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 96 6.2e-21 PFAM
Pfam:Vps53_N 93 424 1.4e-133 PFAM
low complexity region 491 504 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108419
SMART Domains Protein: ENSMUSP00000104057
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 224 4e-11 PFAM
Pfam:Vps53_N 39 233 5.2e-87 PFAM
Pfam:Vps53_N 226 276 1.6e-14 PFAM
low complexity region 343 356 N/A INTRINSIC
low complexity region 643 655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127340
Predicted Effect probably benign
Transcript: ENSMUST00000129256
Predicted Effect probably benign
Transcript: ENSMUST00000129853
SMART Domains Protein: ENSMUSP00000114936
Gene: ENSMUSG00000069808

DomainStartEndE-ValueType
TLC 1 166 6.2e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140886
Predicted Effect probably benign
Transcript: ENSMUST00000163878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166084
Predicted Effect probably benign
Transcript: ENSMUST00000166752
SMART Domains Protein: ENSMUSP00000129159
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:DUF2450 25 225 8.2e-12 PFAM
Pfam:Vps53_N 39 230 6e-87 PFAM
Pfam:Vps53_N 226 405 1.4e-60 PFAM
low complexity region 472 485 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167114
SMART Domains Protein: ENSMUSP00000131663
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 39 101 1.2e-21 PFAM
Pfam:Vps53_N 104 176 3.1e-15 PFAM
low complexity region 243 256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169532
Predicted Effect probably benign
Transcript: ENSMUST00000169734
SMART Domains Protein: ENSMUSP00000130499
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
Pfam:DUF2450 5 225 5.1e-12 PFAM
Pfam:Vps53_N 39 329 1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170143
Predicted Effect probably benign
Transcript: ENSMUST00000170730
SMART Domains Protein: ENSMUSP00000127364
Gene: ENSMUSG00000017288

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
Pfam:Vps53_N 54 123 3e-34 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to the yeast Vps53p protein. Vps53p is involved in retrograde vesicle trafficking in late Golgi. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality prior to E12.5 with trophoblast cell hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Vps53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Vps53 APN 11 76077035 splice site probably null
IGL01596:Vps53 APN 11 76063037 missense probably damaging 1.00
IGL01655:Vps53 APN 11 76063034 missense probably damaging 0.97
IGL02275:Vps53 APN 11 76047123 missense probably benign 0.03
IGL02321:Vps53 APN 11 76048538 missense possibly damaging 0.60
IGL02581:Vps53 APN 11 76102057 missense probably damaging 0.99
IGL02821:Vps53 APN 11 76136317 splice site probably benign
IGL02958:Vps53 APN 11 76117711 missense probably damaging 1.00
IGL03001:Vps53 APN 11 76138324 missense probably damaging 1.00
PIT4519001:Vps53 UTSW 11 76117173 missense probably damaging 1.00
R0391:Vps53 UTSW 11 76121579 missense probably benign 0.31
R0421:Vps53 UTSW 11 76082670 missense probably damaging 1.00
R0882:Vps53 UTSW 11 76082659 missense probably damaging 1.00
R2509:Vps53 UTSW 11 76066835 missense possibly damaging 0.49
R3622:Vps53 UTSW 11 76117783 missense probably benign 0.00
R5137:Vps53 UTSW 11 76166248 missense probably damaging 1.00
R5338:Vps53 UTSW 11 76081208 missense probably damaging 1.00
R5756:Vps53 UTSW 11 76092330 splice site probably benign
R5786:Vps53 UTSW 11 76063007 missense probably benign 0.08
R5961:Vps53 UTSW 11 76048490 missense probably damaging 1.00
R6059:Vps53 UTSW 11 76066867 missense possibly damaging 0.57
R6273:Vps53 UTSW 11 76102018 missense probably benign 0.16
R6490:Vps53 UTSW 11 76077055 missense probably benign 0.03
R6657:Vps53 UTSW 11 76134427 missense probably damaging 1.00
R6671:Vps53 UTSW 11 76134506 missense probably damaging 1.00
R6772:Vps53 UTSW 11 76179498 start codon destroyed probably null
R7378:Vps53 UTSW 11 76077074 missense possibly damaging 0.88
R7735:Vps53 UTSW 11 76047136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCATTGTGAGCTGGTATGAGGAA -3'
(R):5'- CTTGTTGGGAAGAGAAGACTCTTAGGGA -3'

Sequencing Primer
(F):5'- AGTGGGTTATTCACTTCCTAACTG -3'
(R):5'- agccatttcaccagccc -3'
Posted On2013-05-09