Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Aatf'

34795

Institutional Source

Beutler Lab

Gene Symbol

Aatf

Ensembl Gene

ENSMUSG00000018697

Gene Name

apoptosis antagonizing transcription factor

Synonyms

Trb, 4933415H02Rik, 5830465M17Rik, Che-1

MMRRC Submission

038488-MU

Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0257 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

84422855-84513522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 84510281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 171 (E171D)

Ref Sequence

ENSEMBL: ENSMUSP00000018841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018841]

AlphaFold

Q9JKX4

Predicted Effect

probably benign
Transcript: ENSMUST00000018841
AA Change: E171D

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: E171D

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
low complexity region	91	119	N/A	INTRINSIC
low complexity region	130	173	N/A	INTRINSIC
Pfam:AATF-Che1	187	339	4.6e-40	PFAM
low complexity region	418	429	N/A	INTRINSIC
Pfam:TRAUB	430	514	3.2e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148434

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Aatf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Aatf	APN	11	84470557	splice site	probably benign
IGL01482:Aatf	APN	11	84470710	missense	possibly damaging	0.51
IGL01775:Aatf	APN	11	84471137	missense	probably damaging	1.00
IGL02881:Aatf	APN	11	84471289	splice site	probably benign
R0183:Aatf	UTSW	11	84510425	splice site	probably null
R0200:Aatf	UTSW	11	84445676	missense	probably damaging	1.00
R0324:Aatf	UTSW	11	84512139	critical splice donor site	probably null
R0494:Aatf	UTSW	11	84511513	missense	probably benign
R0544:Aatf	UTSW	11	84423005	missense	probably benign	0.09
R1186:Aatf	UTSW	11	84470549	splice site	probably benign
R2339:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R4626:Aatf	UTSW	11	84422958	makesense	probably null
R4647:Aatf	UTSW	11	84471197	missense	possibly damaging	0.69
R4697:Aatf	UTSW	11	84449138	missense	probably damaging	1.00
R4981:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R5490:Aatf	UTSW	11	84510273	missense	probably damaging	1.00
R5938:Aatf	UTSW	11	84442574	missense	possibly damaging	0.88
R6267:Aatf	UTSW	11	84473100	missense	probably benign	0.09
R6296:Aatf	UTSW	11	84473100	missense	probably benign	0.09
R6633:Aatf	UTSW	11	84511482	critical splice donor site	probably null
R7081:Aatf	UTSW	11	84471125	missense	possibly damaging	0.84
R7212:Aatf	UTSW	11	84449180	missense	probably damaging	0.98
R7545:Aatf	UTSW	11	84470676	missense	probably benign	0.04
R7754:Aatf	UTSW	11	84511509	missense	possibly damaging	0.53
R7871:Aatf	UTSW	11	84471038	frame shift	probably null
R8411:Aatf	UTSW	11	84470676	missense	probably benign	0.04
R8746:Aatf	UTSW	11	84511512	missense	probably benign	0.06
R9406:Aatf	UTSW	11	84471040	frame shift	probably null
X0018:Aatf	UTSW	11	84510385	missense	possibly damaging	0.85
Z1176:Aatf	UTSW	11	84442585	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTCCCACAAGGACTAGTGCAGAAC -3'
(R):5'- GTTTCAGGCTACCAGGACTCATGC -3'

Sequencing Primer
(F):5'- TTAATCGAGGCAGGTCAAACTG -3'
(R):5'- GGATCTGAAGATGGGGATTCAG -3'

Posted On

2013-05-09