Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Slc17a3'

34799

Institutional Source

Beutler Lab

Gene Symbol

Slc17a3

Ensembl Gene

ENSMUSG00000036083

Gene Name

solute carrier family 17 (sodium phosphate), member 3

Synonyms

Npt4

MMRRC Submission

038488-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0257 (G1)

Quality Score

200

Status

Validated

Chromosome

Chromosomal Location

23839434-23860716 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 23855858 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 293 (S293F)

Ref Sequence

ENSEMBL: ENSMUSP00000131308 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039721] [ENSMUST00000091698] [ENSMUST00000110422] [ENSMUST00000166467]

AlphaFold

G3UWD9

Predicted Effect

probably damaging
Transcript: ENSMUST00000039721
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039062
Gene: ENSMUSG00000036083
AA Change: S293F

Domain	Start	End	E-Value	Type
Pfam:MFS_1	45	377	3.3e-46	PFAM
transmembrane domain	393	415	N/A	INTRINSIC
transmembrane domain	430	452	N/A	INTRINSIC
transmembrane domain	459	481	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000091698
AA Change: S215F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089290
Gene: ENSMUSG00000036083
AA Change: S215F

Domain	Start	End	E-Value	Type
transmembrane domain	33	55	N/A	INTRINSIC
Pfam:MFS_1	95	293	2.8e-25	PFAM
transmembrane domain	310	332	N/A	INTRINSIC
transmembrane domain	352	369	N/A	INTRINSIC
transmembrane domain	379	398	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110422
AA Change: S257F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106052
Gene: ENSMUSG00000036083
AA Change: S257F

Domain	Start	End	E-Value	Type
Pfam:MFS_1	39	425	6.7e-47	PFAM
transmembrane domain	453	475	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000166467
AA Change: S293F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000131308
Gene: ENSMUSG00000036083
AA Change: S293F

Domain	Start	End	E-Value	Type
Pfam:MFS_1	9	338	2.3e-46	PFAM
transmembrane domain	357	379	N/A	INTRINSIC
transmembrane domain	394	416	N/A	INTRINSIC
transmembrane domain	423	445	N/A	INTRINSIC

Meta Mutation Damage Score

0.8156

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a voltage-driven transporter that excretes intracellular urate and organic anions from the blood into renal tubule cells. Two transcript variants encoding different isoforms have been found for this gene. The longer isoform is a plasma membrane protein with transporter activity while the shorter isoform localizes to the endoplasmic reticulum. [provided by RefSeq, Aug 2012]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Slc17a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00920:Slc17a3	APN	13	23856481	missense	probably benign	0.20
IGL02569:Slc17a3	APN	13	23846302	missense	probably damaging	1.00
IGL02628:Slc17a3	APN	13	23842451	start codon destroyed	probably null	1.00
IGL02745:Slc17a3	APN	13	23842486	missense	probably benign	0.01
IGL03001:Slc17a3	APN	13	23856784	missense	probably damaging	1.00
IGL03143:Slc17a3	APN	13	23855979	splice site	probably null
IGL03144:Slc17a3	APN	13	23846440	missense	probably benign	0.00
R0052:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0054:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0131:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0152:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0153:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0233:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0234:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0294:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0295:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0318:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0319:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0352:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0462:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0610:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0627:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0652:Slc17a3	UTSW	13	23855858	missense	probably damaging	1.00
R0765:Slc17a3	UTSW	13	23846896	nonsense	probably null
R1529:Slc17a3	UTSW	13	23845445	missense	probably damaging	1.00
R1532:Slc17a3	UTSW	13	23856500	missense	probably damaging	1.00
R1569:Slc17a3	UTSW	13	23855608	missense	probably benign	0.09
R1640:Slc17a3	UTSW	13	23852357	nonsense	probably null
R1643:Slc17a3	UTSW	13	23857198	splice site	probably benign
R1715:Slc17a3	UTSW	13	23856741	missense	probably benign	0.19
R2407:Slc17a3	UTSW	13	23852435	critical splice donor site	probably null
R2512:Slc17a3	UTSW	13	23846247	missense	probably benign	0.13
R3923:Slc17a3	UTSW	13	23858054	missense	possibly damaging	0.89
R4449:Slc17a3	UTSW	13	23856732	missense	probably damaging	0.99
R5166:Slc17a3	UTSW	13	23842542	critical splice donor site	probably null
R5748:Slc17a3	UTSW	13	23856466	missense	probably damaging	1.00
R5989:Slc17a3	UTSW	13	23842428	start gained	probably benign
R6281:Slc17a3	UTSW	13	23856799	missense	probably benign	0.17
R6811:Slc17a3	UTSW	13	23855941	missense	possibly damaging	0.61
R7283:Slc17a3	UTSW	13	23855848	missense
R7341:Slc17a3	UTSW	13	23846884	nonsense	probably null
R7467:Slc17a3	UTSW	13	23846967	critical splice donor site	probably null
R7485:Slc17a3	UTSW	13	23855849	missense
R8065:Slc17a3	UTSW	13	23858087	missense	unknown
R8770:Slc17a3	UTSW	13	23855624	missense
R8809:Slc17a3	UTSW	13	23855592	nonsense	probably null
R8867:Slc17a3	UTSW	13	23855960	missense

Predicted Primers

PCR Primer
(F):5'- TGATTTATGATGACCCTGTCTCTCACCC -3'
(R):5'- ACTGTGACAGATGATGCAAACATGAAGA -3'

Sequencing Primer
(F):5'- TCTCTGAACCAACAGGTACATATAAG -3'
(R):5'- TGATGCAAACATGAAGAAGGAATG -3'

Posted On

2013-05-09