Incidental Mutation 'R0257:Serpinb9e'
ID 34800
Institutional Source Beutler Lab
Gene Symbol Serpinb9e
Ensembl Gene ENSMUSG00000062342
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 9e
Synonyms NK26, ovalbumin, Spi14
MMRRC Submission 038488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R0257 (G1)
Quality Score 180
Status Validated
Chromosome 13
Chromosomal Location 33433595-33444833 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 33441664 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 199 (M199L)
Ref Sequence ENSEMBL: ENSMUSP00000071769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071873]
AlphaFold O08806
Predicted Effect probably benign
Transcript: ENSMUST00000071873
AA Change: M199L

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000071769
Gene: ENSMUSG00000062342
AA Change: M199L

DomainStartEndE-ValueType
SERPIN 13 377 1.82e-168 SMART
Meta Mutation Damage Score 0.7191 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T A 11: 84,401,107 (GRCm39) E171D probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adgre5 T A 8: 84,458,624 (GRCm39) H134L possibly damaging Het
Ahsg A T 16: 22,717,790 (GRCm39) M256L probably benign Het
Alk A T 17: 72,910,490 (GRCm39) L72Q probably damaging Het
Ano2 C A 6: 125,857,676 (GRCm39) A505E probably benign Het
Bcas3 A G 11: 85,712,865 (GRCm39) K908E probably benign Het
C3ar1 A G 6: 122,827,746 (GRCm39) V157A probably benign Het
Car2 C G 3: 14,965,037 (GRCm39) H224D probably benign Het
Cfh T C 1: 140,071,773 (GRCm39) D287G probably benign Het
Disp3 G T 4: 148,335,211 (GRCm39) N944K possibly damaging Het
Dlg1 A G 16: 31,661,671 (GRCm39) probably benign Het
Dmbt1 A G 7: 130,708,123 (GRCm39) E1281G probably damaging Het
Dmxl1 T A 18: 50,088,870 (GRCm39) probably benign Het
Dtx3 T C 10: 127,028,761 (GRCm39) D159G probably benign Het
Ets2 T A 16: 95,513,245 (GRCm39) C140* probably null Het
Fbf1 T C 11: 116,045,917 (GRCm39) I226V probably benign Het
Fgd6 T A 10: 93,879,777 (GRCm39) H210Q probably benign Het
Fktn A G 4: 53,734,898 (GRCm39) T179A probably benign Het
Galnt10 T C 11: 57,671,904 (GRCm39) M398T probably damaging Het
Grk5 G T 19: 61,065,068 (GRCm39) probably benign Het
Gse1 A G 8: 121,299,073 (GRCm39) probably benign Het
Hmcn2 T C 2: 31,259,176 (GRCm39) probably benign Het
Iqgap2 A G 13: 95,861,052 (GRCm39) probably null Het
Lama4 T C 10: 38,970,880 (GRCm39) probably benign Het
Luzp2 A G 7: 54,899,194 (GRCm39) T271A probably benign Het
Mdn1 T A 4: 32,693,534 (GRCm39) V1053D probably damaging Het
Mrm1 A C 11: 84,705,649 (GRCm39) probably benign Het
Msh5 G C 17: 35,251,840 (GRCm39) R407G probably damaging Het
Myo1c A T 11: 75,556,342 (GRCm39) probably null Het
Nek5 T C 8: 22,613,688 (GRCm39) probably benign Het
Nrxn2 A G 19: 6,540,728 (GRCm39) I894V possibly damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Pde4a C T 9: 21,103,717 (GRCm39) P175L probably damaging Het
Pip5k1c C A 10: 81,150,930 (GRCm39) A628E possibly damaging Het
Piwil2 C T 14: 70,660,080 (GRCm39) S139N probably benign Het
Prob1 T C 18: 35,786,092 (GRCm39) K721E possibly damaging Het
Rps6ka2 C A 17: 7,495,382 (GRCm39) S57Y probably damaging Het
Rxfp1 C T 3: 79,589,842 (GRCm39) V100M possibly damaging Het
Slc17a3 C T 13: 24,039,841 (GRCm39) S293F probably damaging Het
Slc4a8 G A 15: 100,682,761 (GRCm39) probably benign Het
Sned1 A T 1: 93,192,819 (GRCm39) S369C possibly damaging Het
St18 T A 1: 6,890,186 (GRCm39) F539L probably benign Het
Stam2 C T 2: 52,584,794 (GRCm39) G500D possibly damaging Het
Stx16 G A 2: 173,938,754 (GRCm39) V307M probably benign Het
Svep1 G A 4: 58,179,610 (GRCm39) S211L possibly damaging Het
Tcf12 C T 9: 71,765,904 (GRCm39) S512N probably benign Het
Tiam2 T C 17: 3,501,088 (GRCm39) V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 (GRCm39) A131V probably damaging Het
Tnrc6b C A 15: 80,778,556 (GRCm39) N1176K possibly damaging Het
Trrap C T 5: 144,741,045 (GRCm39) S1264L probably benign Het
Ttn T A 2: 76,640,775 (GRCm39) T13658S possibly damaging Het
Vmn2r104 G A 17: 20,249,889 (GRCm39) T794I probably damaging Het
Vmn2r52 T A 7: 9,904,982 (GRCm39) R286* probably null Het
Vps53 A T 11: 76,068,211 (GRCm39) probably benign Het
Wdr18 A G 10: 79,796,953 (GRCm39) probably benign Het
Wdr31 A G 4: 62,378,755 (GRCm39) probably null Het
Zfp458 T A 13: 67,407,706 (GRCm39) K47* probably null Het
Zfp983 A G 17: 21,880,356 (GRCm39) T95A probably benign Het
Other mutations in Serpinb9e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01619:Serpinb9e APN 13 33,439,108 (GRCm39) missense probably damaging 0.97
IGL02352:Serpinb9e APN 13 33,441,803 (GRCm39) splice site probably benign
IGL02359:Serpinb9e APN 13 33,441,803 (GRCm39) splice site probably benign
IGL02604:Serpinb9e APN 13 33,441,742 (GRCm39) missense probably benign 0.00
IGL02859:Serpinb9e APN 13 33,435,633 (GRCm39) missense possibly damaging 0.83
R0751:Serpinb9e UTSW 13 33,443,757 (GRCm39) missense probably benign 0.00
R1101:Serpinb9e UTSW 13 33,444,071 (GRCm39) missense probably benign 0.10
R1170:Serpinb9e UTSW 13 33,441,735 (GRCm39) nonsense probably null
R1184:Serpinb9e UTSW 13 33,443,757 (GRCm39) missense probably benign 0.00
R1253:Serpinb9e UTSW 13 33,439,102 (GRCm39) missense possibly damaging 0.77
R1405:Serpinb9e UTSW 13 33,444,009 (GRCm39) missense probably benign
R1405:Serpinb9e UTSW 13 33,444,009 (GRCm39) missense probably benign
R1463:Serpinb9e UTSW 13 33,439,099 (GRCm39) missense probably benign
R1566:Serpinb9e UTSW 13 33,437,477 (GRCm39) missense probably damaging 1.00
R1924:Serpinb9e UTSW 13 33,437,428 (GRCm39) missense probably benign 0.07
R1964:Serpinb9e UTSW 13 33,437,474 (GRCm39) missense probably benign 0.04
R2153:Serpinb9e UTSW 13 33,436,961 (GRCm39) missense probably damaging 1.00
R2405:Serpinb9e UTSW 13 33,444,063 (GRCm39) missense probably benign
R2972:Serpinb9e UTSW 13 33,439,126 (GRCm39) missense probably benign
R2973:Serpinb9e UTSW 13 33,439,126 (GRCm39) missense probably benign
R2974:Serpinb9e UTSW 13 33,439,126 (GRCm39) missense probably benign
R3854:Serpinb9e UTSW 13 33,439,137 (GRCm39) missense probably benign 0.40
R4173:Serpinb9e UTSW 13 33,439,141 (GRCm39) missense probably damaging 0.97
R4937:Serpinb9e UTSW 13 33,436,935 (GRCm39) missense probably benign 0.11
R4949:Serpinb9e UTSW 13 33,435,591 (GRCm39) missense possibly damaging 0.81
R5347:Serpinb9e UTSW 13 33,441,767 (GRCm39) missense probably damaging 1.00
R5976:Serpinb9e UTSW 13 33,439,112 (GRCm39) missense probably benign
R5979:Serpinb9e UTSW 13 33,439,036 (GRCm39) missense probably benign 0.18
R5991:Serpinb9e UTSW 13 33,443,790 (GRCm39) missense probably damaging 1.00
R6059:Serpinb9e UTSW 13 33,441,757 (GRCm39) missense probably benign 0.29
R6884:Serpinb9e UTSW 13 33,435,609 (GRCm39) missense probably benign 0.33
R8007:Serpinb9e UTSW 13 33,435,605 (GRCm39) missense probably benign 0.27
R8504:Serpinb9e UTSW 13 33,439,092 (GRCm39) missense probably benign
R9802:Serpinb9e UTSW 13 33,439,078 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCGTCCTtgtgctagttgttgc -3'
(R):5'- CAGAATCTCCTGGCTTACCTTGCTG -3'

Sequencing Primer
(F):5'- gactgaaaaatcccaaagaacaaac -3'
(R):5'- GATGTCCACACCCTGATCTGG -3'
Posted On 2013-05-09