Mutagenetix > Incidental Mutations

Incidental Mutation 'R0257:Slc4a8'

34804

Institutional Source

Beutler Lab

Gene Symbol

Slc4a8

Ensembl Gene

ENSMUSG00000023032

Gene Name

solute carrier family 4 (anion exchanger), member 8

Synonyms

NDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3

MMRRC Submission

038488-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.299) question?

Stock #

R0257 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

100761747-100823968 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 100784880 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000125090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]

Predicted Effect

probably benign
Transcript: ENSMUST00000023776

SMART Domains

Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032

Domain	Start	End	E-Value	Type
low complexity region	60	79	N/A	INTRINSIC
Pfam:Band_3_cyto	145	402	1.4e-105	PFAM
Pfam:HCO3_cotransp	443	956	9.6e-247	PFAM
transmembrane domain	964	986	N/A	INTRINSIC
low complexity region	1010	1027	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162049

SMART Domains

Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032

Domain	Start	End	E-Value	Type
low complexity region	8	27	N/A	INTRINSIC
Pfam:Band_3_cyto	93	350	6.5e-103	PFAM
Pfam:HCO3_cotransp	390	904	1.6e-251	PFAM
transmembrane domain	912	934	N/A	INTRINSIC
low complexity region	958	975	N/A	INTRINSIC

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Slc4a8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Slc4a8	APN	15	100807438	missense	possibly damaging	0.50
IGL01633:Slc4a8	APN	15	100787247	missense	probably damaging	1.00
IGL02945:Slc4a8	APN	15	100807199	critical splice acceptor site	probably null
IGL03172:Slc4a8	APN	15	100799717	missense	probably benign
R0008:Slc4a8	UTSW	15	100800493	missense	possibly damaging	0.67
R0040:Slc4a8	UTSW	15	100789846	missense	probably damaging	0.98
R0040:Slc4a8	UTSW	15	100789846	missense	probably damaging	0.98
R0393:Slc4a8	UTSW	15	100774638	missense	probably damaging	0.99
R0508:Slc4a8	UTSW	15	100789092	missense	probably benign	0.01
R0639:Slc4a8	UTSW	15	100796550	missense	probably damaging	1.00
R1640:Slc4a8	UTSW	15	100783787	missense	probably benign	0.13
R1692:Slc4a8	UTSW	15	100800573	missense	probably damaging	1.00
R1766:Slc4a8	UTSW	15	100787212	missense	probably benign	0.00
R1955:Slc4a8	UTSW	15	100807376	missense	probably damaging	1.00
R2157:Slc4a8	UTSW	15	100806373	missense	probably damaging	1.00
R2206:Slc4a8	UTSW	15	100807445	missense	probably damaging	1.00
R2229:Slc4a8	UTSW	15	100809299	missense	probably damaging	1.00
R2274:Slc4a8	UTSW	15	100807402	missense	probably benign	0.00
R2275:Slc4a8	UTSW	15	100807402	missense	probably benign	0.00
R4299:Slc4a8	UTSW	15	100796640	critical splice donor site	probably null
R4482:Slc4a8	UTSW	15	100810599	missense	probably damaging	1.00
R5038:Slc4a8	UTSW	15	100795821	missense	probably damaging	0.98
R5586:Slc4a8	UTSW	15	100787164	missense	probably damaging	1.00
R5594:Slc4a8	UTSW	15	100795887	missense	probably damaging	1.00
R5804:Slc4a8	UTSW	15	100791625	missense	possibly damaging	0.71
R5815:Slc4a8	UTSW	15	100788211	missense	probably benign	0.42
R5921:Slc4a8	UTSW	15	100814447	splice site	probably benign
R6029:Slc4a8	UTSW	15	100807339	missense	probably benign	0.00
R6212:Slc4a8	UTSW	15	100811571	missense	possibly damaging	0.69
R6321:Slc4a8	UTSW	15	100789164	missense	probably damaging	0.99
R6574:Slc4a8	UTSW	15	100807316	missense	probably damaging	1.00
R6829:Slc4a8	UTSW	15	100800538	missense	probably damaging	1.00
R7023:Slc4a8	UTSW	15	100791643	missense	probably benign	0.00
R7082:Slc4a8	UTSW	15	100791027	missense	probably damaging	1.00
R7197:Slc4a8	UTSW	15	100790976	missense	probably damaging	1.00
R7352:Slc4a8	UTSW	15	100790984	missense	probably damaging	1.00
R7391:Slc4a8	UTSW	15	100784862	missense	probably damaging	0.98
R7627:Slc4a8	UTSW	15	100788223	missense	probably benign	0.08
R7810:Slc4a8	UTSW	15	100798178	missense	possibly damaging	0.72
R8026:Slc4a8	UTSW	15	100787289	missense	not run
Z1088:Slc4a8	UTSW	15	100761951	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CGTGACAGTTCAGGTTTTGCCCTC -3'
(R):5'- TGCTGCTCCCCAAACATGGTAAC -3'

Sequencing Primer
(F):5'- CTGACATCTCATGTTGGCAATATTTG -3'
(R):5'- gtccttccatcaccgattcc -3'

Posted On

2013-05-09