Incidental Mutation 'R0257:Slc4a8'
ID 34804
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Name solute carrier family 4 (anion exchanger), member 8
Synonyms NDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
MMRRC Submission 038488-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.202) question?
Stock # R0257 (G1)
Quality Score 176
Status Validated
Chromosome 15
Chromosomal Location 100761747-100823968 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 100784880 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
AlphaFold Q8JZR6
Predicted Effect probably benign
Transcript: ENSMUST00000023776
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162049
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 (GRCm38) Y577* probably null Het
Aatf T A 11: 84,510,281 (GRCm38) E171D probably benign Het
Adgre5 T A 8: 83,731,995 (GRCm38) H134L possibly damaging Het
Ahsg A T 16: 22,899,040 (GRCm38) M256L probably benign Het
Alk A T 17: 72,603,495 (GRCm38) L72Q probably damaging Het
Ano2 C A 6: 125,880,713 (GRCm38) A505E probably benign Het
Bcas3 A G 11: 85,822,039 (GRCm38) K908E probably benign Het
C3ar1 A G 6: 122,850,787 (GRCm38) V157A probably benign Het
Car2 C G 3: 14,899,977 (GRCm38) H224D probably benign Het
Cfh T C 1: 140,144,035 (GRCm38) D287G probably benign Het
Disp3 G T 4: 148,250,754 (GRCm38) N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 (GRCm38) probably benign Het
Dmbt1 A G 7: 131,106,393 (GRCm38) E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 (GRCm38) probably benign Het
Dtx3 T C 10: 127,192,892 (GRCm38) D159G probably benign Het
Ets2 T A 16: 95,712,201 (GRCm38) C140* probably null Het
Fbf1 T C 11: 116,155,091 (GRCm38) I226V probably benign Het
Fgd6 T A 10: 94,043,915 (GRCm38) H210Q probably benign Het
Fktn A G 4: 53,734,898 (GRCm38) T179A probably benign Het
Galnt10 T C 11: 57,781,078 (GRCm38) M398T probably damaging Het
Grk5 G T 19: 61,076,630 (GRCm38) probably benign Het
Gse1 A G 8: 120,572,334 (GRCm38) probably benign Het
Hmcn2 T C 2: 31,369,164 (GRCm38) probably benign Het
Iqgap2 A G 13: 95,724,544 (GRCm38) probably null Het
Lama4 T C 10: 39,094,884 (GRCm38) probably benign Het
Luzp2 A G 7: 55,249,446 (GRCm38) T271A probably benign Het
Mdn1 T A 4: 32,693,534 (GRCm38) V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 (GRCm38) probably benign Het
Msh5 G C 17: 35,032,864 (GRCm38) R407G probably damaging Het
Myo1c A T 11: 75,665,516 (GRCm38) probably null Het
Nek5 T C 8: 22,123,672 (GRCm38) probably benign Het
Nrxn2 A G 19: 6,490,698 (GRCm38) I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 (GRCm38) T240M probably damaging Het
Pde4a C T 9: 21,192,421 (GRCm38) P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 (GRCm38) A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 (GRCm38) S139N probably benign Het
Prob1 T C 18: 35,653,039 (GRCm38) K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 (GRCm38) S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 (GRCm38) V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 (GRCm38) M199L probably benign Het
Slc17a3 C T 13: 23,855,858 (GRCm38) S293F probably damaging Het
Sned1 A T 1: 93,265,097 (GRCm38) S369C possibly damaging Het
St18 T A 1: 6,819,962 (GRCm38) F539L probably benign Het
Stam2 C T 2: 52,694,782 (GRCm38) G500D possibly damaging Het
Stx16 G A 2: 174,096,961 (GRCm38) V307M probably benign Het
Svep1 G A 4: 58,179,610 (GRCm38) S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 (GRCm38) S512N probably benign Het
Tiam2 T C 17: 3,450,813 (GRCm38) V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 (GRCm38) A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 (GRCm38) N1176K possibly damaging Het
Trrap C T 5: 144,804,235 (GRCm38) S1264L probably benign Het
Ttn T A 2: 76,810,431 (GRCm38) T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 (GRCm38) T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 (GRCm38) R286* probably null Het
Vps53 A T 11: 76,177,385 (GRCm38) probably benign Het
Wdr18 A G 10: 79,961,119 (GRCm38) probably benign Het
Wdr31 A G 4: 62,460,518 (GRCm38) probably null Het
Zfp458 T A 13: 67,259,642 (GRCm38) K47* probably null Het
Zfp983 A G 17: 21,661,440 (GRCm38) T95A probably benign Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100,807,438 (GRCm38) missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100,787,247 (GRCm38) missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100,807,199 (GRCm38) critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100,799,717 (GRCm38) missense probably benign
R0008:Slc4a8 UTSW 15 100,800,493 (GRCm38) missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100,789,846 (GRCm38) missense probably damaging 0.98
R0040:Slc4a8 UTSW 15 100,789,846 (GRCm38) missense probably damaging 0.98
R0393:Slc4a8 UTSW 15 100,774,638 (GRCm38) missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100,789,092 (GRCm38) missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100,796,550 (GRCm38) missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100,783,787 (GRCm38) missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100,800,573 (GRCm38) missense probably damaging 1.00
R1766:Slc4a8 UTSW 15 100,787,212 (GRCm38) missense probably benign 0.00
R1955:Slc4a8 UTSW 15 100,807,376 (GRCm38) missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100,806,373 (GRCm38) missense probably damaging 1.00
R2206:Slc4a8 UTSW 15 100,807,445 (GRCm38) missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100,809,299 (GRCm38) missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100,807,402 (GRCm38) missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100,807,402 (GRCm38) missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100,796,640 (GRCm38) critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100,810,599 (GRCm38) missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100,795,821 (GRCm38) missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100,787,164 (GRCm38) missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100,795,887 (GRCm38) missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100,791,625 (GRCm38) missense possibly damaging 0.71
R5815:Slc4a8 UTSW 15 100,788,211 (GRCm38) missense probably benign 0.42
R5921:Slc4a8 UTSW 15 100,814,447 (GRCm38) splice site probably benign
R6029:Slc4a8 UTSW 15 100,807,339 (GRCm38) missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100,811,571 (GRCm38) missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100,789,164 (GRCm38) missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100,807,316 (GRCm38) missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100,800,538 (GRCm38) missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100,791,643 (GRCm38) missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100,791,027 (GRCm38) missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100,790,976 (GRCm38) missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100,790,984 (GRCm38) missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100,784,862 (GRCm38) missense probably damaging 0.98
R7627:Slc4a8 UTSW 15 100,788,223 (GRCm38) missense probably benign 0.08
R7810:Slc4a8 UTSW 15 100,798,178 (GRCm38) missense possibly damaging 0.72
R7934:Slc4a8 UTSW 15 100,787,292 (GRCm38) missense probably damaging 1.00
R8026:Slc4a8 UTSW 15 100,787,289 (GRCm38) missense possibly damaging 0.72
R8308:Slc4a8 UTSW 15 100,795,854 (GRCm38) missense probably damaging 0.99
R8504:Slc4a8 UTSW 15 100,803,290 (GRCm38) missense possibly damaging 0.56
R8791:Slc4a8 UTSW 15 100,807,253 (GRCm38) missense possibly damaging 0.72
R8919:Slc4a8 UTSW 15 100,814,540 (GRCm38) missense probably benign 0.02
R9155:Slc4a8 UTSW 15 100,774,690 (GRCm38) missense probably damaging 1.00
R9179:Slc4a8 UTSW 15 100,791,601 (GRCm38) missense possibly damaging 0.92
R9253:Slc4a8 UTSW 15 100,783,032 (GRCm38) missense probably benign 0.18
R9422:Slc4a8 UTSW 15 100,800,588 (GRCm38) missense probably benign 0.00
R9457:Slc4a8 UTSW 15 100,806,260 (GRCm38) missense probably damaging 1.00
R9746:Slc4a8 UTSW 15 100,783,840 (GRCm38) missense probably damaging 1.00
Z1088:Slc4a8 UTSW 15 100,761,951 (GRCm38) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTGACAGTTCAGGTTTTGCCCTC -3'
(R):5'- TGCTGCTCCCCAAACATGGTAAC -3'

Sequencing Primer
(F):5'- CTGACATCTCATGTTGGCAATATTTG -3'
(R):5'- gtccttccatcaccgattcc -3'
Posted On 2013-05-09