Mutagenetix > Incidental Mutation

Incidental Mutation 'R0257:Rps6ka2'

34808

Institutional Source

Beutler Lab

Gene Symbol

Rps6ka2

Ensembl Gene

ENSMUSG00000023809

Gene Name

ribosomal protein S6 kinase, polypeptide 2

Synonyms

Rps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3

MMRRC Submission

038488-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.341) question?

Stock #

R0257 (G1)

Quality Score

211

Status

Validated

Chromosome

Chromosomal Location

7170115-7303315 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 7227983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Tyrosine at position 57 (S57Y)

Ref Sequence

ENSEMBL: ENSMUSP00000024575 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024575] [ENSMUST00000232527]

AlphaFold

Q9WUT3

Predicted Effect

probably damaging
Transcript: ENSMUST00000024575
AA Change: S57Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: S57Y

Domain	Start	End	E-Value	Type
low complexity region	18	35	N/A	INTRINSIC
S_TKc	59	318	6.25e-107	SMART
S_TK_X	319	380	3.36e-20	SMART
S_TKc	415	672	1.84e-104	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000232527
AA Change: S23Y

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

Meta Mutation Damage Score

0.4534

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Alk	A	T	17: 72,603,495	L72Q	probably damaging	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Rps6ka2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01782:Rps6ka2	APN	17	7236124	missense	probably benign	0.02
IGL02199:Rps6ka2	APN	17	7254453	splice site	probably benign
IGL02458:Rps6ka2	APN	17	7289003	missense	probably benign	0.04
IGL02532:Rps6ka2	APN	17	7255966	missense	probably damaging	1.00
IGL02741:Rps6ka2	APN	17	7296016	missense	probably benign	0.22
IGL02860:Rps6ka2	APN	17	7282856	missense	possibly damaging	0.68
IGL02948:Rps6ka2	APN	17	7254450	critical splice donor site	probably null
IGL03037:Rps6ka2	APN	17	7254450	critical splice donor site	probably null
IGL03085:Rps6ka2	APN	17	7295280	critical splice donor site	probably null
IGL03302:Rps6ka2	APN	17	7299388	missense	possibly damaging	0.83
IGL03303:Rps6ka2	APN	17	7228012	nonsense	probably null
R0083:Rps6ka2	UTSW	17	7296043	missense	probably benign	0.33
R0108:Rps6ka2	UTSW	17	7296043	missense	probably benign	0.33
R0145:Rps6ka2	UTSW	17	7262186	missense	probably benign	0.09
R0355:Rps6ka2	UTSW	17	7271610	missense	probably benign	0.03
R0563:Rps6ka2	UTSW	17	7254437	missense	probably damaging	1.00
R1065:Rps6ka2	UTSW	17	7281758	splice site	probably benign
R1465:Rps6ka2	UTSW	17	7292867	missense	probably damaging	1.00
R1465:Rps6ka2	UTSW	17	7292867	missense	probably damaging	1.00
R1540:Rps6ka2	UTSW	17	7292906	missense	probably null	1.00
R1708:Rps6ka2	UTSW	17	7277530	missense	probably damaging	0.99
R2418:Rps6ka2	UTSW	17	7299339	missense	possibly damaging	0.76
R2697:Rps6ka2	UTSW	17	7300322	missense	probably benign	0.07
R4427:Rps6ka2	UTSW	17	7299405	missense	possibly damaging	0.90
R4753:Rps6ka2	UTSW	17	7299308	missense	possibly damaging	0.86
R4951:Rps6ka2	UTSW	17	7292789	missense	probably damaging	1.00
R4954:Rps6ka2	UTSW	17	7271604	missense	probably benign	0.00
R4954:Rps6ka2	UTSW	17	7299286	missense	probably benign
R6298:Rps6ka2	UTSW	17	7170367	missense	possibly damaging	0.92
R6800:Rps6ka2	UTSW	17	7251636	missense	probably damaging	1.00
R6905:Rps6ka2	UTSW	17	7227941	missense	probably damaging	1.00
R6952:Rps6ka2	UTSW	17	7227978	missense	probably benign	0.00
R7014:Rps6ka2	UTSW	17	7255932	missense	probably benign	0.29
R7268:Rps6ka2	UTSW	17	7295263	missense	possibly damaging	0.80
R7278:Rps6ka2	UTSW	17	7271635	missense	probably damaging	1.00
R7476:Rps6ka2	UTSW	17	7271633	missense	probably damaging	1.00
R7754:Rps6ka2	UTSW	17	7277449	splice site	probably null
R8124:Rps6ka2	UTSW	17	7281829	missense	possibly damaging	0.95
R8353:Rps6ka2	UTSW	17	7246752	missense	probably benign	0.02
R8453:Rps6ka2	UTSW	17	7246752	missense	probably benign	0.02
R8558:Rps6ka2	UTSW	17	7255917	missense	possibly damaging	0.93
R9047:Rps6ka2	UTSW	17	7300279	missense	probably damaging	0.99
R9142:Rps6ka2	UTSW	17	7170394	missense	probably damaging	0.99
Z1177:Rps6ka2	UTSW	17	7290735	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGACACAGATCATGTCCTGGCCC -3'
(R):5'- TCACGATTCTGACAATCACAGGCTC -3'

Sequencing Primer
(F):5'- GGAATACAATCAGATGTCCCTGTG -3'
(R):5'- TCAACTAATGTGGGCAGTTCC -3'

Posted On

2013-05-09