Incidental Mutation 'R0257:Rps6ka2'
ID 34808
Institutional Source Beutler Lab
Gene Symbol Rps6ka2
Ensembl Gene ENSMUSG00000023809
Gene Name ribosomal protein S6 kinase, polypeptide 2
Synonyms Rps6ka-rs1, pp90rsk, p90rsk, D17Wsu134e, 90kDa, Rsk3
MMRRC Submission 038488-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock # R0257 (G1)
Quality Score 211
Status Validated
Chromosome 17
Chromosomal Location 7170115-7303315 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 7227983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Tyrosine at position 57 (S57Y)
Ref Sequence ENSEMBL: ENSMUSP00000024575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024575] [ENSMUST00000232527]
AlphaFold Q9WUT3
Predicted Effect probably damaging
Transcript: ENSMUST00000024575
AA Change: S57Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024575
Gene: ENSMUSG00000023809
AA Change: S57Y

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
S_TKc 59 318 6.25e-107 SMART
S_TK_X 319 380 3.36e-20 SMART
S_TKc 415 672 1.84e-104 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232527
AA Change: S23Y

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
Meta Mutation Damage Score 0.4534 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RSK (ribosomal S6 kinase) family of serine/threonine kinases. This kinase contains two non-identical kinase catalytic domains and phosphorylates various substrates, including members of the mitogen-activated kinase (MAPK) signalling pathway. The activity of this protein has been implicated in controlling cell growth and differentiation. Alternative splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased response of heart to stress following transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Grk5 G T 19: 61,076,630 probably benign Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Rps6ka2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Rps6ka2 APN 17 7236124 missense probably benign 0.02
IGL02199:Rps6ka2 APN 17 7254453 splice site probably benign
IGL02458:Rps6ka2 APN 17 7289003 missense probably benign 0.04
IGL02532:Rps6ka2 APN 17 7255966 missense probably damaging 1.00
IGL02741:Rps6ka2 APN 17 7296016 missense probably benign 0.22
IGL02860:Rps6ka2 APN 17 7282856 missense possibly damaging 0.68
IGL02948:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03037:Rps6ka2 APN 17 7254450 critical splice donor site probably null
IGL03085:Rps6ka2 APN 17 7295280 critical splice donor site probably null
IGL03302:Rps6ka2 APN 17 7299388 missense possibly damaging 0.83
IGL03303:Rps6ka2 APN 17 7228012 nonsense probably null
R0083:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0108:Rps6ka2 UTSW 17 7296043 missense probably benign 0.33
R0145:Rps6ka2 UTSW 17 7262186 missense probably benign 0.09
R0355:Rps6ka2 UTSW 17 7271610 missense probably benign 0.03
R0563:Rps6ka2 UTSW 17 7254437 missense probably damaging 1.00
R1065:Rps6ka2 UTSW 17 7281758 splice site probably benign
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1465:Rps6ka2 UTSW 17 7292867 missense probably damaging 1.00
R1540:Rps6ka2 UTSW 17 7292906 missense probably null 1.00
R1708:Rps6ka2 UTSW 17 7277530 missense probably damaging 0.99
R2418:Rps6ka2 UTSW 17 7299339 missense possibly damaging 0.76
R2697:Rps6ka2 UTSW 17 7300322 missense probably benign 0.07
R4427:Rps6ka2 UTSW 17 7299405 missense possibly damaging 0.90
R4753:Rps6ka2 UTSW 17 7299308 missense possibly damaging 0.86
R4951:Rps6ka2 UTSW 17 7292789 missense probably damaging 1.00
R4954:Rps6ka2 UTSW 17 7271604 missense probably benign 0.00
R4954:Rps6ka2 UTSW 17 7299286 missense probably benign
R6298:Rps6ka2 UTSW 17 7170367 missense possibly damaging 0.92
R6800:Rps6ka2 UTSW 17 7251636 missense probably damaging 1.00
R6905:Rps6ka2 UTSW 17 7227941 missense probably damaging 1.00
R6952:Rps6ka2 UTSW 17 7227978 missense probably benign 0.00
R7014:Rps6ka2 UTSW 17 7255932 missense probably benign 0.29
R7268:Rps6ka2 UTSW 17 7295263 missense possibly damaging 0.80
R7278:Rps6ka2 UTSW 17 7271635 missense probably damaging 1.00
R7476:Rps6ka2 UTSW 17 7271633 missense probably damaging 1.00
R7754:Rps6ka2 UTSW 17 7277449 splice site probably null
R8124:Rps6ka2 UTSW 17 7281829 missense possibly damaging 0.95
R8353:Rps6ka2 UTSW 17 7246752 missense probably benign 0.02
R8453:Rps6ka2 UTSW 17 7246752 missense probably benign 0.02
R8558:Rps6ka2 UTSW 17 7255917 missense possibly damaging 0.93
R9047:Rps6ka2 UTSW 17 7300279 missense probably damaging 0.99
R9142:Rps6ka2 UTSW 17 7170394 missense probably damaging 0.99
Z1177:Rps6ka2 UTSW 17 7290735 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGACACAGATCATGTCCTGGCCC -3'
(R):5'- TCACGATTCTGACAATCACAGGCTC -3'

Sequencing Primer
(F):5'- GGAATACAATCAGATGTCCCTGTG -3'
(R):5'- TCAACTAATGTGGGCAGTTCC -3'
Posted On 2013-05-09