Mutagenetix > Incidental Mutations

Incidental Mutation 'R0257:Alk'

34813

Institutional Source

Beutler Lab

Gene Symbol

Alk

Ensembl Gene

ENSMUSG00000055471

Gene Name

anaplastic lymphoma kinase

Synonyms

CD246, Tcrz

MMRRC Submission

038488-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.225) question?

Stock #

R0257 (G1)

Quality Score

180

Status

Validated

Chromosome

Chromosomal Location

71869442-72603709 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72603495 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 72 (L72Q)

Ref Sequence

ENSEMBL: ENSMUSP00000083840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086639]

Predicted Effect

probably damaging
Transcript: ENSMUST00000086639
AA Change: L72Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: L72Q

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	99	109	N/A	INTRINSIC
low complexity region	230	242	N/A	INTRINSIC
Pfam:MAM	270	431	5.6e-10	PFAM
LDLa	441	477	5.59e-3	SMART
Pfam:MAM	484	640	5.6e-22	PFAM
Pfam:Gly_rich	730	996	8.6e-19	PFAM
low complexity region	1037	1057	N/A	INTRINSIC
TyrKc	1120	1387	2.76e-140	SMART
low complexity region	1440	1480	N/A	INTRINSIC
low complexity region	1551	1570	N/A	INTRINSIC

Meta Mutation Damage Score

0.2621

Coding Region Coverage

1x: 98.5%
3x: 97.5%
10x: 95.7%
20x: 92.2%

Validation Efficiency

99% (67/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
Aatf	T	A	11: 84,510,281	E171D	probably benign	Het
Adgre5	T	A	8: 83,731,995	H134L	possibly damaging	Het
Ahsg	A	T	16: 22,899,040	M256L	probably benign	Het
Ano2	C	A	6: 125,880,713	A505E	probably benign	Het
Bcas3	A	G	11: 85,822,039	K908E	probably benign	Het
C3ar1	A	G	6: 122,850,787	V157A	probably benign	Het
Car2	C	G	3: 14,899,977	H224D	probably benign	Het
Cfh	T	C	1: 140,144,035	D287G	probably benign	Het
Disp3	G	T	4: 148,250,754	N944K	possibly damaging	Het
Dlg1	A	G	16: 31,842,853		probably benign	Het
Dmbt1	A	G	7: 131,106,393	E1281G	probably damaging	Het
Dmxl1	T	A	18: 49,955,803		probably benign	Het
Dtx3	T	C	10: 127,192,892	D159G	probably benign	Het
Ets2	T	A	16: 95,712,201	C140*	probably null	Het
Fbf1	T	C	11: 116,155,091	I226V	probably benign	Het
Fgd6	T	A	10: 94,043,915	H210Q	probably benign	Het
Fktn	A	G	4: 53,734,898	T179A	probably benign	Het
Galnt10	T	C	11: 57,781,078	M398T	probably damaging	Het
Grk5	G	T	19: 61,076,630		probably benign	Het
Gse1	A	G	8: 120,572,334		probably benign	Het
Hmcn2	T	C	2: 31,369,164		probably benign	Het
Iqgap2	A	G	13: 95,724,544		probably null	Het
Lama4	T	C	10: 39,094,884		probably benign	Het
Luzp2	A	G	7: 55,249,446	T271A	probably benign	Het
Mdn1	T	A	4: 32,693,534	V1053D	probably damaging	Het
Mrm1	A	C	11: 84,814,823		probably benign	Het
Msh5	G	C	17: 35,032,864	R407G	probably damaging	Het
Myo1c	A	T	11: 75,665,516		probably null	Het
Nek5	T	C	8: 22,123,672		probably benign	Het
Nrxn2	A	G	19: 6,490,698	I894V	possibly damaging	Het
Olfr372	C	T	8: 72,058,400	T240M	probably damaging	Het
Pde4a	C	T	9: 21,192,421	P175L	probably damaging	Het
Pip5k1c	C	A	10: 81,315,096	A628E	possibly damaging	Het
Piwil2	C	T	14: 70,422,631	S139N	probably benign	Het
Prob1	T	C	18: 35,653,039	K721E	possibly damaging	Het
Rps6ka2	C	A	17: 7,227,983	S57Y	probably damaging	Het
Rxfp1	C	T	3: 79,682,535	V100M	possibly damaging	Het
Serpinb9e	A	T	13: 33,257,681	M199L	probably benign	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc4a8	G	A	15: 100,784,880		probably benign	Het
Sned1	A	T	1: 93,265,097	S369C	possibly damaging	Het
St18	T	A	1: 6,819,962	F539L	probably benign	Het
Stam2	C	T	2: 52,694,782	G500D	possibly damaging	Het
Stx16	G	A	2: 174,096,961	V307M	probably benign	Het
Svep1	G	A	4: 58,179,610	S211L	possibly damaging	Het
Tcf12	C	T	9: 71,858,622	S512N	probably benign	Het
Tiam2	T	C	17: 3,450,813	V909A	possibly damaging	Het
Tmem64	C	T	4: 15,266,343	A131V	probably damaging	Het
Tnrc6b	C	A	15: 80,894,355	N1176K	possibly damaging	Het
Trrap	C	T	5: 144,804,235	S1264L	probably benign	Het
Ttn	T	A	2: 76,810,431	T13658S	possibly damaging	Het
Vmn2r104	G	A	17: 20,029,627	T794I	probably damaging	Het
Vmn2r52	T	A	7: 10,171,055	R286*	probably null	Het
Vps53	A	T	11: 76,177,385		probably benign	Het
Wdr18	A	G	10: 79,961,119		probably benign	Het
Wdr31	A	G	4: 62,460,518		probably null	Het
Zfp458	T	A	13: 67,259,642	K47*	probably null	Het
Zfp983	A	G	17: 21,661,440	T95A	probably benign	Het

Other mutations in Alk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Alk	APN	17	71895748	missense	probably damaging	1.00
IGL00796:Alk	APN	17	71905142	missense	possibly damaging	0.88
IGL01096:Alk	APN	17	71921896	missense	possibly damaging	0.87
IGL01367:Alk	APN	17	71900786	missense	probably damaging	1.00
IGL01402:Alk	APN	17	71874178	missense	probably damaging	1.00
IGL01652:Alk	APN	17	72603531	missense	probably damaging	1.00
IGL01717:Alk	APN	17	72603382	missense	probably benign
IGL02301:Alk	APN	17	71874176	missense	probably damaging	0.99
IGL02403:Alk	APN	17	71901393	missense	probably damaging	1.00
IGL02452:Alk	APN	17	71902625	nonsense	probably null
IGL02724:Alk	APN	17	71985460	missense	probably benign	0.00
IGL02826:Alk	APN	17	71869536	missense	probably damaging	1.00
IGL02863:Alk	APN	17	71897835	missense	probably damaging	1.00
IGL02994:Alk	APN	17	71949820	missense	probably benign	0.00
IGL03329:Alk	APN	17	71899164	splice site	probably benign
PIT4382001:Alk	UTSW	17	71949921	missense	probably benign
R0157:Alk	UTSW	17	71949845	missense	probably benign	0.00
R0211:Alk	UTSW	17	72603516	missense	probably damaging	1.00
R0269:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0395:Alk	UTSW	17	72603531	missense	probably damaging	0.99
R0414:Alk	UTSW	17	71899286	splice site	probably benign
R0466:Alk	UTSW	17	71905157	missense	possibly damaging	0.51
R0526:Alk	UTSW	17	71869753	missense	probably damaging	1.00
R0617:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0781:Alk	UTSW	17	71984745	splice site	probably benign
R0830:Alk	UTSW	17	72603200	missense	probably benign	0.01
R0835:Alk	UTSW	17	71869842	missense	probably damaging	0.97
R0894:Alk	UTSW	17	71895935	missense	probably damaging	1.00
R1110:Alk	UTSW	17	71984745	splice site	probably benign
R1170:Alk	UTSW	17	71900734	missense	probably damaging	1.00
R1573:Alk	UTSW	17	72603118	missense	possibly damaging	0.69
R1667:Alk	UTSW	17	71911567	missense	probably damaging	1.00
R1748:Alk	UTSW	17	72603421	missense	probably benign	0.19
R1767:Alk	UTSW	17	71900698	missense	possibly damaging	0.73
R1836:Alk	UTSW	17	71891037	missense	probably damaging	1.00
R1861:Alk	UTSW	17	71874938	splice site	probably benign
R2905:Alk	UTSW	17	71985494	missense	probably benign	0.40
R2925:Alk	UTSW	17	72603207	missense	probably benign
R3727:Alk	UTSW	17	71901400	splice site	probably benign
R3747:Alk	UTSW	17	71911565	missense	probably damaging	0.99
R3790:Alk	UTSW	17	72603432	missense	possibly damaging	0.95
R3909:Alk	UTSW	17	71897911	missense	probably benign	0.00
R3934:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3936:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3972:Alk	UTSW	17	71985447	missense	probably benign	0.16
R4433:Alk	UTSW	17	71899241	nonsense	probably null
R4716:Alk	UTSW	17	72205942	missense	probably damaging	1.00
R4903:Alk	UTSW	17	71869563	missense	probably damaging	1.00
R4921:Alk	UTSW	17	71904315	missense	probably benign	0.30
R4954:Alk	UTSW	17	71902692	nonsense	probably null
R5377:Alk	UTSW	17	71895739	missense	probably damaging	1.00
R5386:Alk	UTSW	17	71875012	missense	probably damaging	1.00
R5551:Alk	UTSW	17	71875033	missense	possibly damaging	0.53
R5704:Alk	UTSW	17	72603120	missense	probably damaging	1.00
R5877:Alk	UTSW	17	71967526	missense	probably damaging	1.00
R5888:Alk	UTSW	17	71874943	missense	probably damaging	1.00
R6013:Alk	UTSW	17	71900737	missense	probably benign	0.15
R6044:Alk	UTSW	17	71992100	missense	probably benign	0.00
R6058:Alk	UTSW	17	71869747	missense	probably benign	0.01
R6126:Alk	UTSW	17	71875042	missense	possibly damaging	0.82
R6286:Alk	UTSW	17	71880847	missense	probably damaging	0.98
R6744:Alk	UTSW	17	72603082	missense	probably benign	0.35
R6989:Alk	UTSW	17	71897952	missense	probably benign	0.00
R7487:Alk	UTSW	17	71949898	missense	probably benign
R7573:Alk	UTSW	17	71900792	missense	probably damaging	1.00
R7838:Alk	UTSW	17	71967554	missense	possibly damaging	0.53
R8055:Alk	UTSW	17	71899257	missense	probably benign	0.19
R8211:Alk	UTSW	17	71869707	missense	probably benign
R8555:Alk	UTSW	17	71921874	missense	probably damaging	1.00
RF013:Alk	UTSW	17	71895936	missense	probably damaging	1.00
RF018:Alk	UTSW	17	71949813	missense	probably benign	0.09
Z1088:Alk	UTSW	17	72205807	missense	probably damaging	0.96
Z1177:Alk	UTSW	17	72603063	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAGCCTTCAAGAATCGTCTCCTCG -3'
(R):5'- TTTTGGCAGCAGCCTCGTACTC -3'

Sequencing Primer
(F):5'- CTGTTTGGCACGCCTGAG -3'
(R):5'- AGTTATTCGCGCCTGCAGA -3'

Posted On

2013-05-09