Incidental Mutation 'R0257:Grk5'
ID 34817
Institutional Source Beutler Lab
Gene Symbol Grk5
Ensembl Gene ENSMUSG00000003228
Gene Name G protein-coupled receptor kinase 5
Synonyms Gprk5
MMRRC Submission 038488-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0257 (G1)
Quality Score 96
Status Validated
Chromosome 19
Chromosomal Location 60889749-61092553 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to T at 61076630 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003313] [ENSMUST00000122927]
AlphaFold Q8VEB1
Predicted Effect probably benign
Transcript: ENSMUST00000003313
SMART Domains Protein: ENSMUSP00000003313
Gene: ENSMUSG00000003228

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
RGS 52 171 1.21e-35 SMART
S_TKc 186 448 9.44e-84 SMART
S_TK_X 449 528 1.08e-9 SMART
low complexity region 561 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122927
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.5%
  • 10x: 95.7%
  • 20x: 92.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. It has also been shown to play a role in regulating the motility of polymorphonuclear leukocytes (PMNs). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in a decrease in thermal pain sensation. Mice homozygous for a knock-out allele exhibit decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Aatf T A 11: 84,510,281 E171D probably benign Het
Adgre5 T A 8: 83,731,995 H134L possibly damaging Het
Ahsg A T 16: 22,899,040 M256L probably benign Het
Alk A T 17: 72,603,495 L72Q probably damaging Het
Ano2 C A 6: 125,880,713 A505E probably benign Het
Bcas3 A G 11: 85,822,039 K908E probably benign Het
C3ar1 A G 6: 122,850,787 V157A probably benign Het
Car2 C G 3: 14,899,977 H224D probably benign Het
Cfh T C 1: 140,144,035 D287G probably benign Het
Disp3 G T 4: 148,250,754 N944K possibly damaging Het
Dlg1 A G 16: 31,842,853 probably benign Het
Dmbt1 A G 7: 131,106,393 E1281G probably damaging Het
Dmxl1 T A 18: 49,955,803 probably benign Het
Dtx3 T C 10: 127,192,892 D159G probably benign Het
Ets2 T A 16: 95,712,201 C140* probably null Het
Fbf1 T C 11: 116,155,091 I226V probably benign Het
Fgd6 T A 10: 94,043,915 H210Q probably benign Het
Fktn A G 4: 53,734,898 T179A probably benign Het
Galnt10 T C 11: 57,781,078 M398T probably damaging Het
Gse1 A G 8: 120,572,334 probably benign Het
Hmcn2 T C 2: 31,369,164 probably benign Het
Iqgap2 A G 13: 95,724,544 probably null Het
Lama4 T C 10: 39,094,884 probably benign Het
Luzp2 A G 7: 55,249,446 T271A probably benign Het
Mdn1 T A 4: 32,693,534 V1053D probably damaging Het
Mrm1 A C 11: 84,814,823 probably benign Het
Msh5 G C 17: 35,032,864 R407G probably damaging Het
Myo1c A T 11: 75,665,516 probably null Het
Nek5 T C 8: 22,123,672 probably benign Het
Nrxn2 A G 19: 6,490,698 I894V possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Pde4a C T 9: 21,192,421 P175L probably damaging Het
Pip5k1c C A 10: 81,315,096 A628E possibly damaging Het
Piwil2 C T 14: 70,422,631 S139N probably benign Het
Prob1 T C 18: 35,653,039 K721E possibly damaging Het
Rps6ka2 C A 17: 7,227,983 S57Y probably damaging Het
Rxfp1 C T 3: 79,682,535 V100M possibly damaging Het
Serpinb9e A T 13: 33,257,681 M199L probably benign Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc4a8 G A 15: 100,784,880 probably benign Het
Sned1 A T 1: 93,265,097 S369C possibly damaging Het
St18 T A 1: 6,819,962 F539L probably benign Het
Stam2 C T 2: 52,694,782 G500D possibly damaging Het
Stx16 G A 2: 174,096,961 V307M probably benign Het
Svep1 G A 4: 58,179,610 S211L possibly damaging Het
Tcf12 C T 9: 71,858,622 S512N probably benign Het
Tiam2 T C 17: 3,450,813 V909A possibly damaging Het
Tmem64 C T 4: 15,266,343 A131V probably damaging Het
Tnrc6b C A 15: 80,894,355 N1176K possibly damaging Het
Trrap C T 5: 144,804,235 S1264L probably benign Het
Ttn T A 2: 76,810,431 T13658S possibly damaging Het
Vmn2r104 G A 17: 20,029,627 T794I probably damaging Het
Vmn2r52 T A 7: 10,171,055 R286* probably null Het
Vps53 A T 11: 76,177,385 probably benign Het
Wdr18 A G 10: 79,961,119 probably benign Het
Wdr31 A G 4: 62,460,518 probably null Het
Zfp458 T A 13: 67,259,642 K47* probably null Het
Zfp983 A G 17: 21,661,440 T95A probably benign Het
Other mutations in Grk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02565:Grk5 APN 19 61069371 missense probably damaging 0.99
IGL03183:Grk5 APN 19 61069336 missense probably damaging 0.99
R1565:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1603:Grk5 UTSW 19 61069362 missense probably benign 0.06
R1672:Grk5 UTSW 19 61086215 splice site probably null
R1687:Grk5 UTSW 19 61076783 missense probably damaging 1.00
R1793:Grk5 UTSW 19 61076762 missense probably damaging 1.00
R1822:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1824:Grk5 UTSW 19 61089972 missense probably damaging 0.99
R1876:Grk5 UTSW 19 61083225 missense probably damaging 1.00
R4320:Grk5 UTSW 19 61091945 nonsense probably null
R4828:Grk5 UTSW 19 60987775 nonsense probably null
R5085:Grk5 UTSW 19 61076684 missense probably damaging 1.00
R6237:Grk5 UTSW 19 61089942 missense probably damaging 1.00
R6310:Grk5 UTSW 19 61080911 missense probably damaging 0.96
R6736:Grk5 UTSW 19 60890626 missense probably damaging 0.99
R7061:Grk5 UTSW 19 61046092 missense probably benign 0.00
R7248:Grk5 UTSW 19 60890607 missense probably benign 0.05
R7583:Grk5 UTSW 19 61083204 missense possibly damaging 0.85
R7852:Grk5 UTSW 19 61080945 critical splice donor site probably null
R8810:Grk5 UTSW 19 61089994 missense possibly damaging 0.69
R9082:Grk5 UTSW 19 61046129 missense possibly damaging 0.95
R9729:Grk5 UTSW 19 61090029 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CTGACTAGCCAACTAGGCAGCATC -3'
(R):5'- TGGGAGCACTGCTCACCTATAGAC -3'

Sequencing Primer
(F):5'- GGTATTGGAGCTGTCATCACCC -3'
(R):5'- ACCTATAGACAGTGTTCTCACGG -3'
Posted On 2013-05-09