Incidental Mutation 'R0265:Lamb3'
ID34824
Institutional Source Beutler Lab
Gene Symbol Lamb3
Ensembl Gene ENSMUSG00000026639
Gene Namelaminin, beta 3
Synonymsnicein, 125kDa
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #R0265 (G1)
Quality Score172
Status Validated
Chromosome1
Chromosomal Location193207699-193343878 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 193320531 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 95 (W95R)
Ref Sequence ENSEMBL: ENSMUSP00000142053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016315] [ENSMUST00000159955] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably damaging
Transcript: ENSMUST00000016315
AA Change: W95R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016315
Gene: ENSMUSG00000026639
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159955
AA Change: W95R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123875
Gene: ENSMUSG00000026639
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161526
Predicted Effect probably damaging
Transcript: ENSMUST00000192322
AA Change: W95R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194677
AA Change: W95R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639
AA Change: W95R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Meta Mutation Damage Score 0.9669 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product encoded by this gene is a laminin that belongs to a family of basement membrane proteins. This protein is a beta subunit laminin, which together with an alpha and a gamma subunit, forms laminin-5. Mutations in this gene cause epidermolysis bullosa junctional Herlitz type, and generalized atrophic benign epidermolysis bullosa, diseases that are characterized by blistering of the skin. Multiple alternatively spliced transcript variants that encode the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous intracisternal A particle sequence insertion exhibit blistering of the skin and mucosal surfaces with abnormal hemidesmosomes. Mutants die neonatally, usually without feeding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Lamb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Lamb3 APN 1 193320447 missense probably damaging 1.00
IGL00898:Lamb3 APN 1 193338883 missense possibly damaging 0.81
IGL01599:Lamb3 APN 1 193343412 missense probably benign
IGL02108:Lamb3 APN 1 193332222 missense probably damaging 1.00
IGL02218:Lamb3 APN 1 193328633 critical splice acceptor site probably null
IGL02437:Lamb3 APN 1 193327945 missense probably damaging 1.00
IGL02659:Lamb3 APN 1 193332161 missense probably damaging 1.00
IGL02677:Lamb3 APN 1 193339522 missense probably benign 0.01
IGL02815:Lamb3 APN 1 193325555 splice site probably benign
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0238:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0239:Lamb3 UTSW 1 193321053 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0240:Lamb3 UTSW 1 193335027 missense probably damaging 1.00
R0455:Lamb3 UTSW 1 193343392 missense probably damaging 0.99
R0647:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R0669:Lamb3 UTSW 1 193332330 missense probably damaging 1.00
R0826:Lamb3 UTSW 1 193330908 nonsense probably null
R1552:Lamb3 UTSW 1 193330759 unclassified probably null
R1560:Lamb3 UTSW 1 193339402 missense probably benign 0.05
R1593:Lamb3 UTSW 1 193330796 missense probably damaging 0.99
R1599:Lamb3 UTSW 1 193320493 missense probably damaging 1.00
R1831:Lamb3 UTSW 1 193334879 missense probably damaging 0.99
R1848:Lamb3 UTSW 1 193334616 missense possibly damaging 0.96
R2117:Lamb3 UTSW 1 193334181 missense probably benign 0.00
R2147:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2148:Lamb3 UTSW 1 193327904 missense probably benign 0.00
R2879:Lamb3 UTSW 1 193330784 missense possibly damaging 0.67
R3019:Lamb3 UTSW 1 193331409 critical splice donor site probably null
R4380:Lamb3 UTSW 1 193331375 missense probably benign 0.10
R4648:Lamb3 UTSW 1 193331357 missense probably damaging 0.99
R4758:Lamb3 UTSW 1 193339961 missense possibly damaging 0.65
R4790:Lamb3 UTSW 1 193339886 missense probably damaging 1.00
R4895:Lamb3 UTSW 1 193332314 nonsense probably null
R5316:Lamb3 UTSW 1 193330193 missense probably benign 0.00
R5457:Lamb3 UTSW 1 193325994 missense probably damaging 1.00
R5952:Lamb3 UTSW 1 193332362 missense probably benign 0.04
R5965:Lamb3 UTSW 1 193343460 missense probably damaging 1.00
R6334:Lamb3 UTSW 1 193335474 missense probably damaging 0.96
R6522:Lamb3 UTSW 1 193335453 missense probably benign 0.01
R6725:Lamb3 UTSW 1 193304582 missense probably benign 0.05
R6791:Lamb3 UTSW 1 193334861 missense possibly damaging 0.93
R6828:Lamb3 UTSW 1 193335448 missense probably benign 0.00
R7143:Lamb3 UTSW 1 193304565 missense probably damaging 1.00
R7329:Lamb3 UTSW 1 193320540 missense possibly damaging 0.89
R7439:Lamb3 UTSW 1 193332166 missense possibly damaging 0.80
R7556:Lamb3 UTSW 1 193332449 missense probably benign
R8051:Lamb3 UTSW 1 193330067 missense possibly damaging 0.80
X0066:Lamb3 UTSW 1 193339414 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGACATTGCCAGGTCCTTTGAG -3'
(R):5'- CTGCCTTTAGCATCCAACAGATCCC -3'

Sequencing Primer
(F):5'- GAAGATATGTGCTAGGTTCCCCC -3'
(R):5'- CCCAAAGCAAAGCTGGAAG -3'
Posted On2013-05-09