Incidental Mutation 'R0265:Or5m12'
ID 34829
Institutional Source Beutler Lab
Gene Symbol Or5m12
Ensembl Gene ENSMUSG00000075206
Gene Name olfactory receptor family 5 subfamily M member 12
Synonyms Olfr1024, GA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission 038491-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R0265 (G1)
Quality Score 222
Status Validated
Chromosome 2
Chromosomal Location 85734413-85735396 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 85734591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 269 (N269I)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
AlphaFold A2ASU7
Predicted Effect probably benign
Transcript: ENSMUST00000099912
AA Change: N269I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: N269I

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,822,850 (GRCm39) I321V probably benign Het
Adcy7 A G 8: 89,051,391 (GRCm39) D837G probably damaging Het
Aldh1a1 T A 19: 20,617,440 (GRCm39) Y457* probably null Het
Alox5 T C 6: 116,397,323 (GRCm39) Y287C probably benign Het
Ano8 T C 8: 71,933,168 (GRCm39) probably benign Het
Ap3b1 A G 13: 94,630,189 (GRCm39) K815E unknown Het
Atp11a A T 8: 12,906,930 (GRCm39) probably benign Het
Atp6v0a1 A T 11: 100,939,341 (GRCm39) D702V possibly damaging Het
Cacna1b T A 2: 24,651,856 (GRCm39) N108Y probably damaging Het
Ccdc57 G C 11: 120,812,637 (GRCm39) A39G probably benign Het
Cdhr1 A T 14: 36,803,333 (GRCm39) V581D probably benign Het
Cfap20dc T G 14: 8,431,667 (GRCm38) Y655S probably damaging Het
Cyp2b23 A G 7: 26,372,304 (GRCm39) probably benign Het
D430041D05Rik G C 2: 103,998,295 (GRCm39) P1836R probably damaging Het
Ddit4l C T 3: 137,330,048 (GRCm39) probably benign Het
Dnah8 A T 17: 30,909,245 (GRCm39) I1024F probably benign Het
Dync2i1 T C 12: 116,221,026 (GRCm39) probably benign Het
Edc3 T A 9: 57,634,621 (GRCm39) F213I probably damaging Het
Edrf1 G A 7: 133,258,774 (GRCm39) D717N probably damaging Het
Efna5 G A 17: 62,958,068 (GRCm39) P63S probably damaging Het
Elapor2 T C 5: 9,484,681 (GRCm39) L486P probably damaging Het
Entpd3 A G 9: 120,387,547 (GRCm39) Y248C probably damaging Het
Flcn G A 11: 59,686,635 (GRCm39) Q373* probably null Het
Fry T C 5: 150,358,241 (GRCm39) V1908A probably damaging Het
Gabrg3 A T 7: 57,031,365 (GRCm39) Y58* probably null Het
Gabrp A T 11: 33,502,614 (GRCm39) Y417N probably damaging Het
Golga2 C A 2: 32,194,964 (GRCm39) probably null Het
Grip2 C A 6: 91,750,773 (GRCm39) probably null Het
Gsx2 A G 5: 75,237,729 (GRCm39) Y227C probably damaging Het
H2ac1 T C 13: 24,118,632 (GRCm39) V63A probably benign Het
Hif3a T C 7: 16,769,793 (GRCm39) *665W probably null Het
Hsd3b1 C A 3: 98,760,089 (GRCm39) V301L probably damaging Het
Ifitm5 T C 7: 140,529,921 (GRCm39) probably benign Het
Inpp4a A T 1: 37,418,067 (GRCm39) D498V probably damaging Het
Itga1 A T 13: 115,128,995 (GRCm39) D554E probably benign Het
Itk G A 11: 46,280,285 (GRCm39) probably benign Het
Kdm3b T A 18: 34,928,716 (GRCm39) probably benign Het
Klhl6 A G 16: 19,766,984 (GRCm39) V470A probably benign Het
Lamb3 T A 1: 193,002,839 (GRCm39) W95R probably damaging Het
Lbhd2 T A 12: 111,376,676 (GRCm39) I41N probably damaging Het
Lrp4 A T 2: 91,321,015 (GRCm39) S1014C probably damaging Het
Ltbp2 C T 12: 84,832,743 (GRCm39) probably null Het
Map3k19 A G 1: 127,749,919 (GRCm39) I1144T possibly damaging Het
Mfsd10 T C 5: 34,792,507 (GRCm39) probably benign Het
Mocos A G 18: 24,799,333 (GRCm39) D189G probably benign Het
Mvb12a T A 8: 71,999,654 (GRCm39) F224L probably damaging Het
Myo15a A T 11: 60,405,723 (GRCm39) probably null Het
Nos2 A T 11: 78,828,428 (GRCm39) H249L probably damaging Het
Notum A G 11: 120,549,160 (GRCm39) M184T probably benign Het
Nvl C A 1: 180,962,395 (GRCm39) D192Y probably damaging Het
Or10j3 A G 1: 173,031,484 (GRCm39) K187R probably benign Het
Or4f57 T C 2: 111,790,839 (GRCm39) Y193C probably damaging Het
Or5ac22 A T 16: 59,135,434 (GRCm39) F112Y probably damaging Het
Or8k27 C A 2: 86,276,303 (GRCm39) V8L probably benign Het
Osgin1 A G 8: 120,172,396 (GRCm39) I397V possibly damaging Het
Otulin A G 15: 27,616,510 (GRCm39) V123A probably damaging Het
P4ha1 A G 10: 59,184,081 (GRCm39) Y181C probably damaging Het
Pcdhgc5 A T 18: 37,954,403 (GRCm39) D559V probably damaging Het
Phf2 T C 13: 48,982,270 (GRCm39) N151S unknown Het
Plxnc1 C A 10: 94,648,991 (GRCm39) G1263C probably benign Het
Rad51ap1 A G 6: 126,901,160 (GRCm39) *338Q probably null Het
Raver1 A G 9: 20,986,955 (GRCm39) S676P probably benign Het
Rfx8 T C 1: 39,727,737 (GRCm39) E196G possibly damaging Het
Rreb1 A T 13: 38,100,131 (GRCm39) K187* probably null Het
Rxfp1 T C 3: 79,574,961 (GRCm39) T217A probably benign Het
Rxra T C 2: 27,642,442 (GRCm39) L305P probably damaging Het
Sardh T C 2: 27,117,078 (GRCm39) probably benign Het
Skor2 A T 18: 76,964,293 (GRCm39) E952D probably damaging Het
Slc22a29 A T 19: 8,147,334 (GRCm39) S343T probably benign Het
Sorbs2 T C 8: 46,238,374 (GRCm39) probably benign Het
Supt7l C T 5: 31,673,262 (GRCm39) V329I probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tac1 T C 6: 7,559,165 (GRCm39) probably benign Het
Tcn2 A T 11: 3,872,044 (GRCm39) V361D probably damaging Het
Tm2d3 G A 7: 65,347,582 (GRCm39) A170T possibly damaging Het
Tnks G A 8: 35,307,124 (GRCm39) R1142* probably null Het
Ttll7 C A 3: 146,649,915 (GRCm39) Y648* probably null Het
Umod G T 7: 119,065,296 (GRCm39) Q578K probably benign Het
Upf2 G A 2: 6,032,015 (GRCm39) probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Washc5 A G 15: 59,210,809 (GRCm39) I1013T probably benign Het
Zfp704 C A 3: 9,630,217 (GRCm39) R48L probably damaging Het
Other mutations in Or5m12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Or5m12 APN 2 85,734,714 (GRCm39) missense probably benign
IGL02108:Or5m12 APN 2 85,734,494 (GRCm39) missense possibly damaging 0.67
IGL02738:Or5m12 APN 2 85,735,293 (GRCm39) missense probably benign 0.06
IGL03343:Or5m12 APN 2 85,735,285 (GRCm39) missense probably benign
IGL02802:Or5m12 UTSW 2 85,734,733 (GRCm39) missense probably damaging 1.00
R0271:Or5m12 UTSW 2 85,734,633 (GRCm39) missense possibly damaging 0.68
R0432:Or5m12 UTSW 2 85,734,501 (GRCm39) missense probably damaging 1.00
R0501:Or5m12 UTSW 2 85,735,348 (GRCm39) missense probably damaging 1.00
R0504:Or5m12 UTSW 2 85,735,030 (GRCm39) missense possibly damaging 0.95
R1513:Or5m12 UTSW 2 85,735,015 (GRCm39) missense probably damaging 1.00
R2224:Or5m12 UTSW 2 85,735,099 (GRCm39) missense probably benign 0.11
R2516:Or5m12 UTSW 2 85,734,900 (GRCm39) missense probably benign 0.01
R3845:Or5m12 UTSW 2 85,735,081 (GRCm39) missense probably damaging 0.99
R4871:Or5m12 UTSW 2 85,734,715 (GRCm39) missense probably benign
R4889:Or5m12 UTSW 2 85,735,092 (GRCm39) missense possibly damaging 0.48
R4890:Or5m12 UTSW 2 85,735,092 (GRCm39) missense possibly damaging 0.48
R5543:Or5m12 UTSW 2 85,734,672 (GRCm39) missense probably damaging 1.00
R5865:Or5m12 UTSW 2 85,734,865 (GRCm39) missense probably benign 0.00
R6254:Or5m12 UTSW 2 85,734,849 (GRCm39) missense probably damaging 1.00
R6331:Or5m12 UTSW 2 85,734,560 (GRCm39) missense probably benign 0.32
R6465:Or5m12 UTSW 2 85,734,883 (GRCm39) missense probably benign 0.05
R7183:Or5m12 UTSW 2 85,734,486 (GRCm39) missense probably benign 0.00
R7427:Or5m12 UTSW 2 85,734,475 (GRCm39) nonsense probably null
R7428:Or5m12 UTSW 2 85,734,475 (GRCm39) nonsense probably null
R7552:Or5m12 UTSW 2 85,734,447 (GRCm39) missense probably benign 0.01
R7654:Or5m12 UTSW 2 85,734,663 (GRCm39) missense possibly damaging 0.95
R7674:Or5m12 UTSW 2 85,734,880 (GRCm39) missense probably damaging 1.00
R7980:Or5m12 UTSW 2 85,734,942 (GRCm39) missense probably benign 0.22
R8209:Or5m12 UTSW 2 85,734,547 (GRCm39) missense probably benign 0.14
R8226:Or5m12 UTSW 2 85,734,547 (GRCm39) missense probably benign 0.14
Z1177:Or5m12 UTSW 2 85,735,389 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCATAGGTACTGAGCTTTTCTCCAC -3'
(R):5'- GGGCACAATGCAGGTGATATTGACTTC -3'

Sequencing Primer
(F):5'- GTACTGAGCTTTTCTCCACTTTGC -3'
(R):5'- CAGGTGATATTGACTTCACGTC -3'
Posted On 2013-05-09