Incidental Mutation 'R0265:Olfr1024'
ID34829
Institutional Source Beutler Lab
Gene Symbol Olfr1024
Ensembl Gene ENSMUSG00000075206
Gene Nameolfactory receptor 1024
SynonymsGA_x6K02T2Q125-47384320-47383337, MOR197-1
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0265 (G1)
Quality Score222
Status Validated
Chromosome2
Chromosomal Location85904069-85905052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85904247 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 269 (N269I)
Ref Sequence ENSEMBL: ENSMUSP00000097496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099912]
Predicted Effect probably benign
Transcript: ENSMUST00000099912
AA Change: N269I

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000097496
Gene: ENSMUSG00000075206
AA Change: N269I

DomainStartEndE-ValueType
Pfam:7tm_4 36 313 7.6e-52 PFAM
Pfam:7tm_1 46 295 4.1e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215677
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Olfr1024
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01632:Olfr1024 APN 2 85904370 missense probably benign
IGL02108:Olfr1024 APN 2 85904150 missense possibly damaging 0.67
IGL02738:Olfr1024 APN 2 85904949 missense probably benign 0.06
IGL03343:Olfr1024 APN 2 85904941 missense probably benign
IGL02802:Olfr1024 UTSW 2 85904389 missense probably damaging 1.00
R0271:Olfr1024 UTSW 2 85904289 missense possibly damaging 0.68
R0432:Olfr1024 UTSW 2 85904157 missense probably damaging 1.00
R0501:Olfr1024 UTSW 2 85905004 missense probably damaging 1.00
R0504:Olfr1024 UTSW 2 85904686 missense possibly damaging 0.95
R1513:Olfr1024 UTSW 2 85904671 missense probably damaging 1.00
R2224:Olfr1024 UTSW 2 85904755 missense probably benign 0.11
R2516:Olfr1024 UTSW 2 85904556 missense probably benign 0.01
R3845:Olfr1024 UTSW 2 85904737 missense probably damaging 0.99
R4871:Olfr1024 UTSW 2 85904371 missense probably benign
R4889:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R4890:Olfr1024 UTSW 2 85904748 missense possibly damaging 0.48
R5543:Olfr1024 UTSW 2 85904328 missense probably damaging 1.00
R5865:Olfr1024 UTSW 2 85904521 missense probably benign 0.00
R6254:Olfr1024 UTSW 2 85904505 missense probably damaging 1.00
R6331:Olfr1024 UTSW 2 85904216 missense probably benign 0.32
R6465:Olfr1024 UTSW 2 85904539 missense probably benign 0.05
R7183:Olfr1024 UTSW 2 85904142 missense probably benign 0.00
R7427:Olfr1024 UTSW 2 85904131 nonsense probably null
R7428:Olfr1024 UTSW 2 85904131 nonsense probably null
R7552:Olfr1024 UTSW 2 85904103 missense probably benign 0.01
R7654:Olfr1024 UTSW 2 85904319 missense possibly damaging 0.95
R7674:Olfr1024 UTSW 2 85904536 missense probably damaging 1.00
R7980:Olfr1024 UTSW 2 85904598 missense probably benign 0.22
R8209:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
R8226:Olfr1024 UTSW 2 85904203 missense probably benign 0.14
Z1177:Olfr1024 UTSW 2 85905045 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCATAGGTACTGAGCTTTTCTCCAC -3'
(R):5'- GGGCACAATGCAGGTGATATTGACTTC -3'

Sequencing Primer
(F):5'- GTACTGAGCTTTTCTCCACTTTGC -3'
(R):5'- CAGGTGATATTGACTTCACGTC -3'
Posted On2013-05-09