Mutagenetix > Incidental Mutations

Incidental Mutation 'R3946:Tle4'

348319

Institutional Source

Beutler Lab

Gene Symbol

Tle4

Ensembl Gene

ENSMUSG00000024642

Gene Name

transducin-like enhancer of split 4

Synonyms

Bce1, ESTM14, 5730411M05Rik, Grg4, ESTM13

MMRRC Submission

040827-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3946 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

14448072-14598051 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14597388 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 9 (Y9N)

Ref Sequence

ENSEMBL: ENSMUSP00000126249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000052011] [ENSMUST00000167776]

Predicted Effect

probably damaging
Transcript: ENSMUST00000052011
AA Change: Y9N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057527
Gene: ENSMUSG00000024642
AA Change: Y9N

Domain	Start	End	E-Value	Type
Pfam:TLE_N	8	138	9.1e-76	PFAM
low complexity region	164	178	N/A	INTRINSIC
low complexity region	201	216	N/A	INTRINSIC
low complexity region	226	238	N/A	INTRINSIC
low complexity region	289	316	N/A	INTRINSIC
WD40	477	514	4.18e-2	SMART
WD40	520	561	3.64e-2	SMART
WD40	566	605	9.38e-5	SMART
WD40	608	647	1.14e-8	SMART
WD40	650	688	2.29e1	SMART
WD40	690	729	7.39e-3	SMART
WD40	730	770	4.14e-1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167776
AA Change: Y9N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126249
Gene: ENSMUSG00000024642
AA Change: Y9N

Domain	Start	End	E-Value	Type
Pfam:TLE_N	8	138	5.1e-76	PFAM
low complexity region	164	178	N/A	INTRINSIC
low complexity region	199	216	N/A	INTRINSIC
low complexity region	226	238	N/A	INTRINSIC
low complexity region	289	316	N/A	INTRINSIC
WD40	477	514	4.18e-2	SMART
WD40	520	561	3.64e-2	SMART
WD40	566	605	9.38e-5	SMART
WD40	608	647	1.14e-8	SMART
WD40	650	688	2.29e1	SMART
WD40	690	729	7.39e-3	SMART
WD40	730	770	4.14e-1	SMART

Meta Mutation Damage Score

0.5619

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.1%

Validation Efficiency

98% (60/61)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele are runted and die around 4 weeks of age with leukocytopenia, B cell lymphopenia, reduced bone mineralization and reduced hematopoietic stem cell number and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aaed1	T	C	13: 64,309,098	I104V	probably damaging	Het
Abi2	A	G	1: 60,453,754	Q328R	probably damaging	Het
Agr3	C	A	12: 35,947,513		probably benign	Het
Brca2	T	A	5: 150,536,704	S481R	probably damaging	Het
Cabin1	T	G	10: 75,745,259	Q411P	probably damaging	Het
Calr3	A	G	8: 72,443,620	Y22H	probably damaging	Het
Caprin1	T	A	2: 103,796,766	I59F	probably damaging	Het
Cdk5rap1	T	C	2: 154,348,716	T442A	probably damaging	Het
Chn2	T	C	6: 54,269,426		probably benign	Het
Cic	C	A	7: 25,272,346	R501S	possibly damaging	Het
Coch	A	G	12: 51,601,812		probably null	Het
Defa25	G	A	8: 21,084,490	V17I	probably null	Het
Dglucy	T	C	12: 100,838,700		probably null	Het
Dtx1	T	G	5: 120,681,286	T616P	possibly damaging	Het
Eef1g	T	C	19: 8,969,977	L171P	probably benign	Het
Fam135a	A	G	1: 24,030,394	S465P	probably damaging	Het
Gm14025	A	G	2: 129,039,601	L135P	probably damaging	Het
Gm14412	A	T	2: 177,314,685	C472*	probably null	Het
Gm7104	T	C	12: 88,286,042		noncoding transcript	Het
Got2	A	G	8: 95,888,230	S26P	probably benign	Het
H2-M11	A	G	17: 36,549,231	I329M	probably damaging	Het
Hmcn2	T	A	2: 31,382,394	D1295E	possibly damaging	Het
Hoxd12	G	T	2: 74,675,427	R114L	probably damaging	Het
Ilkap	A	C	1: 91,387,250	D124E	probably damaging	Het
Med6	T	C	12: 81,581,851	Y88C	probably damaging	Het
Mep1a	A	T	17: 43,475,041	L719*	probably null	Het
Mmp23	T	C	4: 155,652,023	Y187C	probably damaging	Het
Myo1g	A	G	11: 6,520,760	M32T	possibly damaging	Het
Ncstn	T	C	1: 172,067,494	E614G	probably benign	Het
Nr2c2	C	T	6: 92,163,138	R464W	probably damaging	Het
Olfr1309	G	A	2: 111,983,297	T259M	possibly damaging	Het
Otub2	T	A	12: 103,392,826	L58*	probably null	Het
Pcdhga12	G	A	18: 37,767,629	V505I	probably benign	Het
Pcdhga9	T	A	18: 37,737,844	V242D	probably damaging	Het
Pex1	C	T	5: 3,626,084	L891F	probably damaging	Het
Pgm1	C	T	5: 64,112,061	T497I	probably benign	Het
Pikfyve	T	C	1: 65,196,681	F171L	probably damaging	Het
Pilrb1	T	G	5: 137,857,392	K79T	probably benign	Het
Pin1	C	T	9: 20,655,364	R21W	probably damaging	Het
Ptprq	A	G	10: 107,686,392		probably benign	Het
Rad17	G	A	13: 100,622,863	A552V	possibly damaging	Het
Rbbp8	A	G	18: 11,718,868	T249A	probably benign	Het
Rtkn	A	T	6: 83,135,976	I10F	probably benign	Het
Scube2	T	A	7: 109,857,590	I103F	possibly damaging	Het
Sec23b	A	G	2: 144,581,973	H514R	probably benign	Het
Serbp1	T	A	6: 67,272,220	D223E	probably benign	Het
Slc14a1	C	A	18: 78,111,392	V260L	probably benign	Het
Slc22a23	A	G	13: 34,183,126	I633T	probably damaging	Het
Stk19	A	T	17: 34,824,747		probably benign	Het
Svs2	T	C	2: 164,237,127	M287V	probably benign	Het
Syne3	T	A	12: 104,958,066	Q358L	probably damaging	Het
Synj1	A	G	16: 91,010,096	F58L	possibly damaging	Het
Tg	T	C	15: 66,674,023	V198A	probably damaging	Het
Tmem57	A	G	4: 134,804,481	Y626H	probably damaging	Het
Tmx3	G	A	18: 90,524,335	A186T	possibly damaging	Het
Traf3	G	A	12: 111,255,245	S280N	possibly damaging	Het
Trmt13	A	G	3: 116,581,518	F447S	probably damaging	Het
Trp53bp1	T	A	2: 121,228,626	H918L	probably damaging	Het
Ush2a	T	G	1: 188,728,504	V2654G	probably benign	Het
Vmn2r25	A	G	6: 123,840,098	Y175H	probably damaging	Het
Zfp335	T	C	2: 164,892,189	D1330G	probably damaging	Het

Other mutations in Tle4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Tle4	APN	19	14468261	missense	probably benign	0.00
IGL01449:Tle4	APN	19	14465340	missense	probably benign	0.00
IGL01618:Tle4	APN	19	14544814	missense	probably benign	0.07
IGL01636:Tle4	APN	19	14452533	missense	probably damaging	0.97
IGL01750:Tle4	APN	19	14449789	missense	probably damaging	1.00
IGL02376:Tle4	APN	19	14594404	missense	probably damaging	1.00
BB006:Tle4	UTSW	19	14517880	missense	probably benign	0.09
BB016:Tle4	UTSW	19	14517880	missense	probably benign	0.09
R0006:Tle4	UTSW	19	14466714	splice site	probably benign
R1068:Tle4	UTSW	19	14452179	missense	probably damaging	1.00
R1174:Tle4	UTSW	19	14468262	missense	probably benign
R1594:Tle4	UTSW	19	14453606	nonsense	probably null
R1671:Tle4	UTSW	19	14453739	missense	probably damaging	1.00
R1891:Tle4	UTSW	19	14544786	critical splice donor site	probably null
R1951:Tle4	UTSW	19	14516357	critical splice donor site	probably null
R2068:Tle4	UTSW	19	14449749	nonsense	probably null
R3858:Tle4	UTSW	19	14468213	missense	probably benign	0.11
R3859:Tle4	UTSW	19	14468213	missense	probably benign	0.11
R4357:Tle4	UTSW	19	14468261	missense	probably benign	0.00
R4395:Tle4	UTSW	19	14517938	missense	probably benign	0.20
R4491:Tle4	UTSW	19	14454865	missense	probably damaging	1.00
R4860:Tle4	UTSW	19	14464345	missense	probably benign	0.30
R4860:Tle4	UTSW	19	14464345	missense	probably benign	0.30
R5336:Tle4	UTSW	19	14454739	critical splice donor site	probably null
R5516:Tle4	UTSW	19	14454889	missense	probably damaging	0.99
R5611:Tle4	UTSW	19	14449795	missense	probably damaging	1.00
R6032:Tle4	UTSW	19	14452108	missense	possibly damaging	0.74
R6032:Tle4	UTSW	19	14452108	missense	possibly damaging	0.74
R6113:Tle4	UTSW	19	14595588	critical splice donor site	probably null
R6513:Tle4	UTSW	19	14451692	missense	probably damaging	0.99
R6995:Tle4	UTSW	19	14564453	critical splice acceptor site	probably null
R7175:Tle4	UTSW	19	14451707	missense	probably damaging	1.00
R7310:Tle4	UTSW	19	14517791	missense	probably benign	0.04
R7929:Tle4	UTSW	19	14517880	missense	probably benign	0.09
R8369:Tle4	UTSW	19	14452512	missense	probably benign	0.03
R8396:Tle4	UTSW	19	14454959	nonsense	probably null
R8847:Tle4	UTSW	19	14516373	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTACCCGGAATCGAAAGTG -3'
(R):5'- TTCATTCCGAGGAATAGCAGCC -3'

Sequencing Primer
(F):5'- AATCGAAAGTGGCCCGTC -3'
(R):5'- TCCGAGGAATAGCAGCCAATTAAAAG -3'

Posted On

2015-10-05