Incidental Mutation 'R3158:Gm20939'
ID348330
Institutional Source Beutler Lab
Gene Symbol Gm20939
Ensembl Gene ENSMUSG00000095193
Gene Namepredicted gene, 20939
Synonyms
MMRRC Submission 040609-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R3158 (G1)
Quality Score49
Status Validated
Chromosome17
Chromosomal Location94873986-94877497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94877293 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 456 (H456Q)
Ref Sequence ENSEMBL: ENSMUSP00000103642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108007]
Predicted Effect probably damaging
Transcript: ENSMUST00000108007
AA Change: H456Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103642
Gene: ENSMUSG00000095193
AA Change: H456Q

DomainStartEndE-ValueType
KRAB 3 65 7.59e-15 SMART
ZnF_C2H2 130 152 5.21e-4 SMART
ZnF_C2H2 158 180 1.18e-2 SMART
ZnF_C2H2 186 208 2.12e-4 SMART
ZnF_C2H2 214 236 2.57e-3 SMART
ZnF_C2H2 242 264 1.3e-4 SMART
ZnF_C2H2 270 292 2.99e-4 SMART
ZnF_C2H2 298 320 7.9e-4 SMART
ZnF_C2H2 326 348 1.6e-4 SMART
ZnF_C2H2 354 376 4.24e-4 SMART
ZnF_C2H2 382 404 2.79e-4 SMART
ZnF_C2H2 410 432 5.14e-3 SMART
ZnF_C2H2 438 460 1.22e-4 SMART
ZnF_C2H2 466 488 4.17e-3 SMART
ZnF_C2H2 494 516 1.6e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aoc2 A T 11: 101,329,276 N696I probably damaging Het
Ccr4 G T 9: 114,492,282 N238K probably benign Het
Cd300e A C 11: 115,062,023 M1R probably null Het
Cep95 A G 11: 106,809,187 probably benign Het
Cfap54 T C 10: 92,999,056 I1096V probably benign Het
Clca4b C A 3: 144,912,117 V742L probably benign Het
Diaph3 A T 14: 86,656,456 I39N possibly damaging Het
Dll3 A T 7: 28,294,095 D566E possibly damaging Het
Dmpk A G 7: 19,093,019 T579A probably benign Het
E330034G19Rik A T 14: 24,296,897 Y84F possibly damaging Het
Eya1 G A 1: 14,304,467 probably benign Het
Fat4 A G 3: 38,890,791 T1278A possibly damaging Het
Galnt12 A G 4: 47,104,264 D174G probably damaging Het
Gm7853 A G 14: 36,089,401 noncoding transcript Het
Hsd3b5 G A 3: 98,622,059 A85V probably benign Het
Itga11 A G 9: 62,769,278 K916R probably benign Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Krt6a T C 15: 101,691,366 Y437C probably damaging Het
Lrp5 A G 19: 3,615,849 S707P probably damaging Het
Med14 G A X: 12,684,091 probably benign Het
Mmp11 C T 10: 75,927,114 probably benign Het
Mtus2 A G 5: 148,231,827 H950R probably damaging Het
Myo1g G T 11: 6,514,527 T511K possibly damaging Het
Myo7a A G 7: 98,052,292 F2154S probably damaging Het
Olfr1098 C T 2: 86,922,606 E309K probably benign Het
Olfr1453 G C 19: 13,028,047 A94G probably benign Het
Olfr749 A G 14: 50,736,814 V116A probably benign Het
Prss52 G T 14: 64,113,543 W259L probably damaging Het
Sbk2 G A 7: 4,957,527 R215* probably null Het
Sectm1a A G 11: 121,068,777 I175T probably benign Het
Smu1 T A 4: 40,754,529 R123S possibly damaging Het
Stk3 A G 15: 35,008,241 S178P possibly damaging Het
Tle6 T C 10: 81,595,204 probably null Het
Vmn2r37 C T 7: 9,217,714 M383I probably benign Het
Other mutations in Gm20939
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Gm20939 APN 17 94874293 splice site probably benign
R0015:Gm20939 UTSW 17 94876768 missense probably benign 0.00
R1563:Gm20939 UTSW 17 94877094 missense probably damaging 1.00
R1714:Gm20939 UTSW 17 94875806 missense probably damaging 1.00
R2029:Gm20939 UTSW 17 94875824 splice site probably benign
R2922:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R2923:Gm20939 UTSW 17 94877293 missense probably damaging 1.00
R3810:Gm20939 UTSW 17 94876710 missense possibly damaging 0.46
R4158:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R4304:Gm20939 UTSW 17 94877281 missense probably benign
R4307:Gm20939 UTSW 17 94876734 missense possibly damaging 0.72
R5080:Gm20939 UTSW 17 94876991 missense probably damaging 1.00
R5271:Gm20939 UTSW 17 94877155 nonsense probably null
R5661:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R5771:Gm20939 UTSW 17 94874339 missense possibly damaging 0.93
R6800:Gm20939 UTSW 17 94877229 missense possibly damaging 0.75
R8393:Gm20939 UTSW 17 94875779 missense probably damaging 1.00
R8791:Gm20939 UTSW 17 94877220 missense probably damaging 1.00
Z1088:Gm20939 UTSW 17 94877433 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGTAAAGTCTTTGGACGACA -3'
(R):5'- ATGGCTTTGTCACATTGGTTATATT -3'

Sequencing Primer
(F):5'- AGTCTTTGGACGACACAGTC -3'
(R):5'- CACAGAGTTACTCTTTAGTATGTGC -3'
Posted On2015-10-08