Incidental Mutation 'R3720:Gm10717'
ID348331
Institutional Source Beutler Lab
Gene Symbol Gm10717
Ensembl Gene ENSMUSG00000095891
Gene Namepredicted gene 10717
Synonyms
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.803) question?
Stock #R3720 (G1)
Quality Score20
Status Validated
Chromosome9
Chromosomal Location3025417-3033289 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3025532 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 39 (Y39C)
Ref Sequence ENSEMBL: ENSMUSP00000096644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075573] [ENSMUST00000099042] [ENSMUST00000099046] [ENSMUST00000099047] [ENSMUST00000099051] [ENSMUST00000177601] [ENSMUST00000177875] [ENSMUST00000179272] [ENSMUST00000179982]
Predicted Effect probably benign
Transcript: ENSMUST00000075573
AA Change: Y39C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096644
Gene: ENSMUSG00000095891
AA Change: Y39C

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.06e-10 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 177 1.06e-10 PROSPERO
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099042
SMART Domains Protein: ENSMUSP00000096640
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 47 9.09e-8 PROSPERO
transmembrane domain 76 98 N/A INTRINSIC
internal_repeat_1 117 164 9.09e-8 PROSPERO
transmembrane domain 195 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099046
SMART Domains Protein: ENSMUSP00000096645
Gene: ENSMUSG00000095186

DomainStartEndE-ValueType
internal_repeat_1 1 41 4.44e-7 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 177 4.44e-7 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099047
SMART Domains Protein: ENSMUSP00000096646
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 40 1.58e-10 PROSPERO
transmembrane domain 53 72 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
internal_repeat_1 117 176 1.58e-10 PROSPERO
transmembrane domain 199 221 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099051
SMART Domains Protein: ENSMUSP00000096650
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 2 38 6.22e-5 PROSPERO
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 90 109 N/A INTRINSIC
internal_repeat_1 118 174 6.22e-5 PROSPERO
transmembrane domain 185 207 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177601
SMART Domains Protein: ENSMUSP00000136755
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_2 1 24 2.26e-6 PROSPERO
internal_repeat_1 2 37 2.26e-6 PROSPERO
internal_repeat_1 40 95 2.26e-6 PROSPERO
internal_repeat_2 118 142 2.26e-6 PROSPERO
low complexity region 147 159 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177875
SMART Domains Protein: ENSMUSP00000137419
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 49 1.49e-11 PROSPERO
transmembrane domain 68 90 N/A INTRINSIC
internal_repeat_1 118 186 1.49e-11 PROSPERO
transmembrane domain 197 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179272
SMART Domains Protein: ENSMUSP00000136170
Gene: ENSMUSG00000095547

DomainStartEndE-ValueType
internal_repeat_1 1 49 2.1e-10 PROSPERO
transmembrane domain 74 96 N/A INTRINSIC
internal_repeat_1 118 186 2.1e-10 PROSPERO
transmembrane domain 198 217 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179982
SMART Domains Protein: ENSMUSP00000136365
Gene: ENSMUSG00000095891

DomainStartEndE-ValueType
internal_repeat_1 1 35 7.76e-13 PROSPERO
transmembrane domain 67 89 N/A INTRINSIC
internal_repeat_1 117 152 7.76e-13 PROSPERO
low complexity region 157 169 N/A INTRINSIC
transmembrane domain 198 220 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181957
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Gm10717
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Gm10717 APN 9 3025511 missense probably damaging 1.00
IGL01635:Gm10717 APN 9 3025506 missense possibly damaging 0.46
IGL01864:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01865:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01866:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01873:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01875:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01877:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01878:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01879:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01880:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01882:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01886:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01887:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01892:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01893:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01897:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01901:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01903:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01904:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01907:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01908:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01913:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01919:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01920:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01923:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01925:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01927:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01930:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01931:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01932:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL01935:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01941:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01948:Gm10717 APN 9 3025819 missense probably damaging 1.00
IGL01949:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01951:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL01952:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02106:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02142:Gm10717 APN 9 3025616 missense probably benign 0.00
IGL02592:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02609:Gm10717 APN 9 3026287 missense probably damaging 0.98
IGL02802:Gm10717 UTSW 9 3031999 missense probably benign
R0277:Gm10717 UTSW 9 3025619 missense possibly damaging 0.79
R1813:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R1911:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R2399:Gm10717 UTSW 9 3025532 missense probably benign
R2874:Gm10717 UTSW 9 3025532 missense probably benign
R3617:Gm10717 UTSW 9 3025532 missense probably benign
R4988:Gm10717 UTSW 9 3026368 missense probably benign 0.00
R5002:Gm10717 UTSW 9 3025532 missense probably benign
R5117:Gm10717 UTSW 9 3025625 missense probably benign 0.00
R5367:Gm10717 UTSW 9 3026317 missense probably damaging 1.00
R5539:Gm10717 UTSW 9 3030438 missense probably damaging 1.00
R5623:Gm10717 UTSW 9 3026318 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACAGTGGACATTTCTAAATTTTCGAC -3'
(R):5'- AGAAATGCACACTGTAGGACC -3'

Sequencing Primer
(F):5'- GCCATATTTCATGTCCCAAAGTGTG -3'
(R):5'- TGCACACTGTAGGACCTGGAATATG -3'
Posted On2015-10-08