Incidental Mutation 'R3720:Neurl1b'
ID348332
Institutional Source Beutler Lab
Gene Symbol Neurl1b
Ensembl Gene ENSMUSG00000034413
Gene Nameneuralized E3 ubiquitin protein ligase 1B
SynonymsC230078M08Rik, Neur2, EG240055
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R3720 (G1)
Quality Score30
Status Validated
Chromosome17
Chromosomal Location26414829-26446349 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26414975 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 4 (T4M)
Ref Sequence ENSEMBL: ENSMUSP00000138417 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053020] [ENSMUST00000182897] [ENSMUST00000183077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053020
AA Change: T4M

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051481
Gene: ENSMUSG00000034413
AA Change: T4M

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 192 1e-12 BLAST
Blast:NEUZ 219 245 1e-8 BLAST
NEUZ 268 390 7.66e-24 SMART
low complexity region 436 449 N/A INTRINSIC
low complexity region 457 486 N/A INTRINSIC
RING 494 533 2.38e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182897
AA Change: T4M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138417
Gene: ENSMUSG00000034413
AA Change: T4M

DomainStartEndE-ValueType
Blast:NEUZ 37 63 5e-9 BLAST
Pfam:Neuralized 88 156 2.8e-14 PFAM
low complexity region 254 267 N/A INTRINSIC
low complexity region 275 304 N/A INTRINSIC
RING 312 351 2.38e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000183077
AA Change: T4M

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138178
Gene: ENSMUSG00000034413
AA Change: T4M

DomainStartEndE-ValueType
NEUZ 36 159 5.7e-41 SMART
Blast:NEUZ 161 225 2e-14 BLAST
low complexity region 226 255 N/A INTRINSIC
RING 263 302 2.38e-2 SMART
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Neurl1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Neurl1b APN 17 26432178 missense probably damaging 0.99
R0530:Neurl1b UTSW 17 26441545 splice site probably null
R1819:Neurl1b UTSW 17 26438700 missense probably benign 0.01
R2359:Neurl1b UTSW 17 26441595 missense probably benign 0.03
R4574:Neurl1b UTSW 17 26431886 missense probably benign 0.19
R7508:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7509:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7642:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7654:Neurl1b UTSW 17 26438697 missense probably benign 0.00
R7669:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7670:Neurl1b UTSW 17 26438746 missense probably benign 0.13
R7722:Neurl1b UTSW 17 26441158 missense probably benign
R8069:Neurl1b UTSW 17 26432227 missense probably damaging 1.00
R8343:Neurl1b UTSW 17 26431991 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAAACTTTCAAAAGACGC -3'
(R):5'- GCCAAGAACTAGCACGTGTG -3'

Sequencing Primer
(F):5'- CTTTCAAAAGACGCGGCGG -3'
(R):5'- GACCTCCGGCTGGAACAAAG -3'
Posted On2015-10-08