Incidental Mutation 'R3720:Ldb1'
ID348333
Institutional Source Beutler Lab
Gene Symbol Ldb1
Ensembl Gene ENSMUSG00000025223
Gene NameLIM domain binding 1
SynonymsCLIM2
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3720 (G1)
Quality Score23
Status Validated
Chromosome19
Chromosomal Location46032593-46045214 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 46044892 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026252] [ENSMUST00000152946] [ENSMUST00000156585] [ENSMUST00000185355]
Predicted Effect probably benign
Transcript: ENSMUST00000026252
SMART Domains Protein: ENSMUSP00000026252
Gene: ENSMUSG00000025223

DomainStartEndE-ValueType
Pfam:LIM_bind 32 236 1e-72 PFAM
low complexity region 264 287 N/A INTRINSIC
PDB:2JTN|A 295 339 1e-22 PDB
low complexity region 355 368 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134015
Predicted Effect probably benign
Transcript: ENSMUST00000152946
SMART Domains Protein: ENSMUSP00000116909
Gene: ENSMUSG00000025223

DomainStartEndE-ValueType
Pfam:LIM_bind 33 189 1.1e-42 PFAM
Pfam:LIM_bind 178 235 5.5e-15 PFAM
low complexity region 264 287 N/A INTRINSIC
PDB:2YPA|D 298 337 4e-21 PDB
low complexity region 353 366 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156585
SMART Domains Protein: ENSMUSP00000118546
Gene: ENSMUSG00000025223

DomainStartEndE-ValueType
Pfam:LIM_bind 69 225 5.9e-42 PFAM
Pfam:LIM_bind 214 271 2.5e-14 PFAM
low complexity region 300 323 N/A INTRINSIC
PDB:2JTN|A 331 375 2e-22 PDB
low complexity region 391 404 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185355
SMART Domains Protein: ENSMUSP00000139562
Gene: ENSMUSG00000025223

DomainStartEndE-ValueType
Pfam:LIM_bind 68 272 5.6e-73 PFAM
low complexity region 300 323 N/A INTRINSIC
PDB:2JTN|A 331 375 2e-22 PDB
low complexity region 391 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos at E9.5-E10 with impaired primitive erythropoiesis and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Ldb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Ldb1 APN 19 46035575 missense probably damaging 1.00
IGL02069:Ldb1 APN 19 46033178 missense possibly damaging 0.88
IGL02380:Ldb1 APN 19 46034490 missense possibly damaging 0.95
IGL02441:Ldb1 APN 19 46035756 missense probably damaging 0.99
IGL02677:Ldb1 APN 19 46036155 splice site probably benign
R1585:Ldb1 UTSW 19 46034464 missense probably damaging 0.99
R4897:Ldb1 UTSW 19 46034693 missense probably benign
R5830:Ldb1 UTSW 19 46034118 missense probably benign 0.00
R7663:Ldb1 UTSW 19 46035524 missense probably damaging 1.00
X0027:Ldb1 UTSW 19 46034089 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCCCTCTAACTCTATACAGC -3'
(R):5'- TTAATAAAGCCCGGCCCAG -3'

Sequencing Primer
(F):5'- TCTAACTCTATACAGCCCCCG -3'
(R):5'- CGTACACACGCAGAGGCAG -3'
Posted On2015-10-08