Incidental Mutation 'R4670:Itih5'
ID 348342
Institutional Source Beutler Lab
Gene Symbol Itih5
Ensembl Gene ENSMUSG00000025780
Gene Name inter-alpha-trypsin inhibitor, heavy chain 5
Synonyms 4631408O11Rik, 5430408M01Rik
MMRRC Submission 041926-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R4670 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 10158382-10261340 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 10195180 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 191 (I191L)
Ref Sequence ENSEMBL: ENSMUSP00000026886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026886]
AlphaFold Q8BJD1
Predicted Effect probably benign
Transcript: ENSMUST00000026886
AA Change: I191L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000026886
Gene: ENSMUSG00000025780
AA Change: I191L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
Pfam:VIT 51 159 5.5e-27 PFAM
VWA 293 476 5.84e-24 SMART
Pfam:ITI_HC_C 716 909 1.7e-60 PFAM
Meta Mutation Damage Score 0.2863 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (69/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heavy chain component of one of the inter-alpha-trypsin inhibitor (ITI) family members. ITI proteins are involved in extracellular matrix stabilization and in the prevention of tumor metastasis. They are also structurally related plasma serine protease inhibitors and are composed of a light chain and varying numbers of heavy chains. This family member is thought to function as a tumor suppressor in breast and thyroid cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,130,983 (GRCm39) probably null Het
Alb T A 5: 90,610,665 (GRCm39) S82T probably benign Het
Arf4 A G 14: 26,374,248 (GRCm39) probably benign Het
Arhgap22 T C 14: 33,084,500 (GRCm39) C260R probably damaging Het
Arhgap32 A G 9: 32,081,441 (GRCm39) E153G probably benign Het
Arhgef18 T A 8: 3,484,897 (GRCm39) M200K probably damaging Het
Atp1a4 T A 1: 172,062,567 (GRCm39) N647Y probably benign Het
Atp5f1c A T 2: 10,064,428 (GRCm39) L226Q probably damaging Het
Bcas1 T C 2: 170,226,245 (GRCm39) K310R probably damaging Het
Cadm3 T A 1: 173,174,013 (GRCm39) T67S probably damaging Het
Cartpt C T 13: 100,036,588 (GRCm39) probably null Het
Cenpj A T 14: 56,790,840 (GRCm39) V403E possibly damaging Het
Chst7 C A X: 19,927,110 (GRCm39) R386S probably damaging Het
Cyp4f37 A T 17: 32,844,126 (GRCm39) M77L probably benign Het
Dnah7b A T 1: 46,117,684 (GRCm39) D50V probably damaging Het
Galnt4 A G 10: 98,945,160 (GRCm39) D295G possibly damaging Het
Gin1 C T 1: 97,712,565 (GRCm39) P154S probably damaging Het
Gm6471 G A 7: 142,385,360 (GRCm39) noncoding transcript Het
Gm6818 T A 7: 38,101,981 (GRCm39) noncoding transcript Het
Gm9271 T A 7: 39,013,734 (GRCm39) noncoding transcript Het
Gpam A G 19: 55,084,551 (GRCm39) probably null Het
Gpr183 T C 14: 122,192,149 (GRCm39) D124G probably damaging Het
Ift140 C A 17: 25,317,935 (GRCm39) probably benign Het
Jcad A G 18: 4,674,175 (GRCm39) T646A probably benign Het
Kank1 T C 19: 25,387,944 (GRCm39) M511T probably benign Het
Krt74 A T 15: 101,667,304 (GRCm39) noncoding transcript Het
Lrrc37a A G 11: 103,395,363 (GRCm39) S21P probably benign Het
Lrrc8c G A 5: 105,756,240 (GRCm39) V672I probably benign Het
Lypd4 T C 7: 24,566,151 (GRCm39) R58G probably benign Het
Magi1 A T 6: 93,663,624 (GRCm39) probably null Het
Mefv T A 16: 3,526,071 (GRCm39) L745F possibly damaging Het
Myh13 A T 11: 67,255,564 (GRCm39) K1645* probably null Het
Naip6 A G 13: 100,431,239 (GRCm39) probably null Het
Nlrp1c-ps T C 11: 71,171,382 (GRCm39) noncoding transcript Het
Nsmce3 A T 7: 64,522,530 (GRCm39) L46Q probably benign Het
Or51aa2 A G 7: 103,188,393 (GRCm39) V16A possibly damaging Het
Or6k6 T A 1: 173,945,427 (GRCm39) M52L probably benign Het
Or8k37 T C 2: 86,469,512 (GRCm39) D180G possibly damaging Het
P2ry12 T C 3: 59,125,325 (GRCm39) probably null Het
Pcx T A 19: 4,669,916 (GRCm39) V861E probably damaging Het
Pkp3 C T 7: 140,662,612 (GRCm39) P75S probably benign Het
Plscr4 T C 9: 92,364,920 (GRCm39) probably null Het
Pole A G 5: 110,454,253 (GRCm39) T923A probably benign Het
Ptgir A G 7: 16,640,794 (GRCm39) M29V possibly damaging Het
Rhot2 A C 17: 26,060,305 (GRCm39) probably benign Het
Rsrp1 A G 4: 134,651,488 (GRCm39) Y84C unknown Het
Sbf2 T C 7: 109,934,606 (GRCm39) K1348E probably damaging Het
Sgip1 A T 4: 102,726,951 (GRCm39) N53Y probably damaging Het
Snapc2 A G 8: 4,304,998 (GRCm39) T127A possibly damaging Het
Snx8 A G 5: 140,341,713 (GRCm39) probably null Het
Spag8 A G 4: 43,653,378 (GRCm39) probably benign Het
Srebf2 T C 15: 82,076,503 (GRCm39) F718L probably damaging Het
Szt2 C G 4: 118,233,026 (GRCm39) probably benign Het
Traf3ip2 C T 10: 39,515,256 (GRCm39) P345S possibly damaging Het
Tubgcp4 T A 2: 121,004,146 (GRCm39) Y62* probably null Het
Usp29 T A 7: 6,965,914 (GRCm39) S586T possibly damaging Het
Vasp T C 7: 18,998,350 (GRCm39) N108S probably benign Het
Vmn1r214 A G 13: 23,219,141 (GRCm39) M212V probably benign Het
Wipi2 G C 5: 142,645,345 (GRCm39) A194P probably benign Het
Zbtb4 T A 11: 69,667,355 (GRCm39) I220N probably damaging Het
Zcchc2 A T 1: 105,917,996 (GRCm39) probably benign Het
Zfp729a T A 13: 67,769,534 (GRCm39) K232* probably null Het
Zfp995 A T 17: 22,106,320 (GRCm39) M1K probably null Het
Other mutations in Itih5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Itih5 APN 2 10,195,100 (GRCm39) missense probably damaging 1.00
IGL02125:Itih5 APN 2 10,245,798 (GRCm39) missense probably benign
IGL02370:Itih5 APN 2 10,191,786 (GRCm39) missense probably benign 0.05
IGL03376:Itih5 APN 2 10,211,584 (GRCm39) missense probably benign 0.12
IGL02991:Itih5 UTSW 2 10,256,162 (GRCm39) missense probably benign 0.01
R0090:Itih5 UTSW 2 10,169,495 (GRCm39) missense probably benign 0.03
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0096:Itih5 UTSW 2 10,256,189 (GRCm39) missense probably benign 0.02
R0158:Itih5 UTSW 2 10,239,803 (GRCm39) splice site probably benign
R0270:Itih5 UTSW 2 10,256,075 (GRCm39) missense probably benign 0.38
R0276:Itih5 UTSW 2 10,190,375 (GRCm39) missense possibly damaging 0.80
R0807:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0810:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0903:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0905:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R0906:Itih5 UTSW 2 10,253,999 (GRCm39) missense probably benign 0.00
R1104:Itih5 UTSW 2 10,256,323 (GRCm39) missense probably benign 0.03
R1397:Itih5 UTSW 2 10,245,618 (GRCm39) missense probably benign 0.14
R1671:Itih5 UTSW 2 10,191,782 (GRCm39) missense probably benign 0.03
R1971:Itih5 UTSW 2 10,243,379 (GRCm39) missense probably damaging 1.00
R3684:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3685:Itih5 UTSW 2 10,243,435 (GRCm39) missense possibly damaging 0.93
R3831:Itih5 UTSW 2 10,256,081 (GRCm39) missense possibly damaging 0.95
R3934:Itih5 UTSW 2 10,250,355 (GRCm39) missense probably damaging 0.98
R4803:Itih5 UTSW 2 10,245,392 (GRCm39) missense probably benign
R4950:Itih5 UTSW 2 10,239,892 (GRCm39) missense probably damaging 0.98
R5020:Itih5 UTSW 2 10,245,315 (GRCm39) splice site probably null
R5735:Itih5 UTSW 2 10,245,572 (GRCm39) missense probably benign 0.00
R6454:Itih5 UTSW 2 10,245,479 (GRCm39) missense probably benign
R6662:Itih5 UTSW 2 10,253,992 (GRCm39) missense probably benign 0.13
R7019:Itih5 UTSW 2 10,195,138 (GRCm39) missense probably damaging 1.00
R7068:Itih5 UTSW 2 10,254,115 (GRCm39) missense probably damaging 0.99
R7246:Itih5 UTSW 2 10,191,873 (GRCm39) splice site probably null
R7424:Itih5 UTSW 2 10,250,448 (GRCm39) missense probably damaging 1.00
R7452:Itih5 UTSW 2 10,243,607 (GRCm39) missense probably damaging 1.00
R7597:Itih5 UTSW 2 10,254,187 (GRCm39) missense probably damaging 1.00
R8025:Itih5 UTSW 2 10,245,833 (GRCm39) missense probably benign 0.13
R8253:Itih5 UTSW 2 10,243,406 (GRCm39) missense probably benign 0.06
R8349:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8439:Itih5 UTSW 2 10,239,869 (GRCm39) missense probably benign 0.19
R8449:Itih5 UTSW 2 10,191,800 (GRCm39) missense probably benign 0.01
R8825:Itih5 UTSW 2 10,195,231 (GRCm39) missense probably benign 0.00
R9110:Itih5 UTSW 2 10,191,831 (GRCm39) missense probably benign
R9582:Itih5 UTSW 2 10,195,013 (GRCm39) missense probably benign 0.07
R9744:Itih5 UTSW 2 10,256,221 (GRCm39) missense probably damaging 1.00
X0026:Itih5 UTSW 2 10,243,370 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCCCTGAGCTTAACTGTGGTC -3'
(R):5'- TCCCATTAACATGCAAAGCCTTTG -3'

Sequencing Primer
(F):5'- TTCTTCCTAACAGAGAAAACGGG -3'
(R):5'- GCAGAAGGGGCGCCATTTC -3'
Posted On 2015-10-08