Mutagenetix > Incidental Mutation

Incidental Mutation 'R4670:Szt2'

348347

Institutional Source

Beutler Lab

Gene Symbol

Szt2

Ensembl Gene

ENSMUSG00000033253

Gene Name

seizure threshold 2

Synonyms

MMRRC Submission

041926-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.539) question?

Stock #

R4670 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

118362743-118409273 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to G at 118375829 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075406]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000075406
AA Change: W2313C

SMART Domains

Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: W2313C

Domain	Start	End	E-Value	Type
low complexity region	48	64	N/A	INTRINSIC
Blast:VWA	93	343	1e-109	BLAST
low complexity region	704	728	N/A	INTRINSIC
low complexity region	762	775	N/A	INTRINSIC
low complexity region	779	793	N/A	INTRINSIC
low complexity region	875	887	N/A	INTRINSIC
low complexity region	994	1011	N/A	INTRINSIC
low complexity region	1351	1370	N/A	INTRINSIC
low complexity region	1619	1630	N/A	INTRINSIC
low complexity region	1662	1678	N/A	INTRINSIC
low complexity region	1832	1854	N/A	INTRINSIC
low complexity region	1862	1881	N/A	INTRINSIC
low complexity region	1895	1914	N/A	INTRINSIC
low complexity region	2176	2184	N/A	INTRINSIC
low complexity region	2284	2292	N/A	INTRINSIC
low complexity region	2309	2323	N/A	INTRINSIC
low complexity region	2373	2384	N/A	INTRINSIC
low complexity region	2500	2508	N/A	INTRINSIC
low complexity region	2669	2680	N/A	INTRINSIC
low complexity region	2739	2758	N/A	INTRINSIC
low complexity region	3239	3252	N/A	INTRINSIC
low complexity region	3257	3268	N/A	INTRINSIC
low complexity region	3283	3309	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138386

Predicted Effect

probably benign
Transcript: ENSMUST00000183402

Meta Mutation Damage Score

0.0776

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,531,760		probably null	Het
Alb	T	A	5: 90,462,806	S82T	probably benign	Het
Arf4	A	G	14: 26,653,093		probably benign	Het
Arhgap22	T	C	14: 33,362,543	C260R	probably damaging	Het
Arhgap32	A	G	9: 32,170,145	E153G	probably benign	Het
Arhgef18	T	A	8: 3,434,897	M200K	probably damaging	Het
Atp1a4	T	A	1: 172,235,000	N647Y	probably benign	Het
Atp5c1	A	T	2: 10,059,617	L226Q	probably damaging	Het
Bcas1	T	C	2: 170,384,325	K310R	probably damaging	Het
Cadm3	T	A	1: 173,346,446	T67S	probably damaging	Het
Cartpt	C	T	13: 99,900,080		probably null	Het
Cenpj	A	T	14: 56,553,383	V403E	possibly damaging	Het
Chst7	C	A	X: 20,060,871	R386S	probably damaging	Het
Cyp4f37	A	T	17: 32,625,152	M77L	probably benign	Het
Dnah7b	A	T	1: 46,078,524	D50V	probably damaging	Het
Galnt4	A	G	10: 99,109,298	D295G	possibly damaging	Het
Gin1	C	T	1: 97,784,840	P154S	probably damaging	Het
Gm6471	G	A	7: 142,831,623		noncoding transcript	Het
Gm6818	T	A	7: 38,402,557		noncoding transcript	Het
Gm9271	T	A	7: 39,364,310		noncoding transcript	Het
Gpam	A	G	19: 55,096,119		probably null	Het
Gpr183	T	C	14: 121,954,737	D124G	probably damaging	Het
Ift140	C	A	17: 25,098,961		probably benign	Het
Itih5	A	C	2: 10,190,369	I191L	probably benign	Het
Jcad	A	G	18: 4,674,175	T646A	probably benign	Het
Kank1	T	C	19: 25,410,580	M511T	probably benign	Het
Krt74	A	T	15: 101,758,869		noncoding transcript	Het
Lrrc37a	A	G	11: 103,504,537	S21P	probably benign	Het
Lrrc8c	G	A	5: 105,608,374	V672I	probably benign	Het
Lypd4	T	C	7: 24,866,726	R58G	probably benign	Het
Magi1	A	T	6: 93,686,643		probably null	Het
Mefv	T	A	16: 3,708,207	L745F	possibly damaging	Het
Myh13	A	T	11: 67,364,738	K1645*	probably null	Het
Naip6	A	G	13: 100,294,731		probably null	Het
Nlrp1c-ps	T	C	11: 71,280,556		noncoding transcript	Het
Nsmce3	A	T	7: 64,872,782	L46Q	probably benign	Het
Olfr1084	T	C	2: 86,639,168	D180G	possibly damaging	Het
Olfr231	T	A	1: 174,117,861	M52L	probably benign	Het
Olfr612	A	G	7: 103,539,186	V16A	possibly damaging	Het
P2ry12	T	C	3: 59,217,904		probably null	Het
Pcx	T	A	19: 4,619,888	V861E	probably damaging	Het
Pkp3	C	T	7: 141,082,699	P75S	probably benign	Het
Plscr4	T	C	9: 92,482,867		probably null	Het
Pole	A	G	5: 110,306,387	T923A	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rhot2	A	C	17: 25,841,331		probably benign	Het
Rsrp1	A	G	4: 134,924,177	Y84C	unknown	Het
Sbf2	T	C	7: 110,335,399	K1348E	probably damaging	Het
Sgip1	A	T	4: 102,869,754	N53Y	probably damaging	Het
Snapc2	A	G	8: 4,254,998	T127A	possibly damaging	Het
Snx8	A	G	5: 140,355,958		probably null	Het
Spag8	A	G	4: 43,653,378		probably benign	Het
Srebf2	T	C	15: 82,192,302	F718L	probably damaging	Het
Traf3ip2	C	T	10: 39,639,260	P345S	possibly damaging	Het
Tubgcp4	T	A	2: 121,173,665	Y62*	probably null	Het
Usp29	T	A	7: 6,962,915	S586T	possibly damaging	Het
Vasp	T	C	7: 19,264,425	N108S	probably benign	Het
Vmn1r214	A	G	13: 23,034,971	M212V	probably benign	Het
Wipi2	G	C	5: 142,659,590	A194P	probably benign	Het
Zbtb4	T	A	11: 69,776,529	I220N	probably damaging	Het
Zcchc2	A	T	1: 105,990,266		probably benign	Het
Zfp729a	T	A	13: 67,621,415	K232*	probably null	Het
Zfp995	A	T	17: 21,887,339	M1K	probably null	Het

Other mutations in Szt2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Szt2	APN	4	118384250	splice site	probably benign
IGL01082:Szt2	APN	4	118397624	missense	probably damaging	1.00
IGL01348:Szt2	APN	4	118393624	splice site	probably benign
IGL01869:Szt2	APN	4	118399071	missense	possibly damaging	0.87
IGL01918:Szt2	APN	4	118384253	splice site	probably benign
IGL01951:Szt2	APN	4	118376493	unclassified	probably benign
IGL01971:Szt2	APN	4	118386955	missense	probably benign	0.01
IGL02047:Szt2	APN	4	118376637	unclassified	probably benign
IGL02092:Szt2	APN	4	118363332	unclassified	probably benign
IGL02120:Szt2	APN	4	118388564	missense	probably benign	0.01
IGL02210:Szt2	APN	4	118389823	missense	possibly damaging	0.95
IGL02435:Szt2	APN	4	118390823	missense	probably damaging	1.00
IGL02622:Szt2	APN	4	118392890	missense	probably damaging	0.96
IGL02666:Szt2	APN	4	118374055	missense	probably damaging	0.99
IGL02712:Szt2	APN	4	118384833	missense	probably benign	0.19
IGL02983:Szt2	APN	4	118365779	unclassified	probably benign
IGL03026:Szt2	APN	4	118391849	missense	probably benign	0.40
IGL03178:Szt2	APN	4	118382689	missense	unknown
IGL03233:Szt2	APN	4	118372529	missense	unknown
IGL03377:Szt2	APN	4	118402397	splice site	probably benign
IGL03387:Szt2	APN	4	118364725	unclassified	probably benign
PIT4687001:Szt2	UTSW	4	118398201	missense	possibly damaging	0.84
R0026:Szt2	UTSW	4	118384772	missense	possibly damaging	0.92
R0352:Szt2	UTSW	4	118382593	missense	unknown
R0396:Szt2	UTSW	4	118376347	unclassified	probably benign
R0504:Szt2	UTSW	4	118372952	splice site	probably null
R1033:Szt2	UTSW	4	118387106	missense	probably damaging	0.98
R1222:Szt2	UTSW	4	118405459	missense	possibly damaging	0.77
R1418:Szt2	UTSW	4	118387779	missense	probably benign	0.03
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1462:Szt2	UTSW	4	118373967	missense	unknown
R1763:Szt2	UTSW	4	118372368	missense	unknown
R1772:Szt2	UTSW	4	118405517	missense	probably damaging	1.00
R1840:Szt2	UTSW	4	118365657	unclassified	probably benign
R1942:Szt2	UTSW	4	118392620	missense	probably benign	0.17
R1965:Szt2	UTSW	4	118383965	missense	probably benign	0.36
R1998:Szt2	UTSW	4	118375727	critical splice donor site	probably null
R2009:Szt2	UTSW	4	118378064	critical splice donor site	probably null
R2012:Szt2	UTSW	4	118363665	unclassified	probably benign
R2044:Szt2	UTSW	4	118376448	nonsense	probably null
R2066:Szt2	UTSW	4	118373980	missense	unknown
R2345:Szt2	UTSW	4	118381397	missense	unknown
R2857:Szt2	UTSW	4	118369402	missense	probably damaging	1.00
R3156:Szt2	UTSW	4	118402819	critical splice donor site	probably null
R3236:Szt2	UTSW	4	118383034	splice site	probably null
R3237:Szt2	UTSW	4	118383034	splice site	probably null
R3405:Szt2	UTSW	4	118394020	missense	probably benign	0.02
R3795:Szt2	UTSW	4	118391730	missense	probably damaging	1.00
R3878:Szt2	UTSW	4	118390585	missense	probably damaging	1.00
R3906:Szt2	UTSW	4	118378269	unclassified	probably benign
R4012:Szt2	UTSW	4	118383900	missense	probably benign	0.02
R4039:Szt2	UTSW	4	118364952	unclassified	probably benign
R4081:Szt2	UTSW	4	118373567	splice site	probably benign
R4298:Szt2	UTSW	4	118365406	unclassified	probably benign
R4299:Szt2	UTSW	4	118365406	unclassified	probably benign
R4432:Szt2	UTSW	4	118384231	missense	probably damaging	0.99
R4597:Szt2	UTSW	4	118372681	missense	unknown
R4657:Szt2	UTSW	4	118397669	missense	probably benign	0.06
R4663:Szt2	UTSW	4	118377684	unclassified	probably benign
R4704:Szt2	UTSW	4	118393829	missense	probably damaging	0.99
R4748:Szt2	UTSW	4	118389191	nonsense	probably null
R4786:Szt2	UTSW	4	118399062	missense	probably benign	0.20
R4809:Szt2	UTSW	4	118388985	missense	probably damaging	1.00
R4830:Szt2	UTSW	4	118369248	missense	unknown
R4944:Szt2	UTSW	4	118388669	missense	probably benign	0.03
R5077:Szt2	UTSW	4	118369616	critical splice donor site	probably null
R5121:Szt2	UTSW	4	118385444	missense	possibly damaging	0.92
R5140:Szt2	UTSW	4	118386981	missense	possibly damaging	0.46
R5169:Szt2	UTSW	4	118389830	missense	probably benign	0.26
R5198:Szt2	UTSW	4	118388322	missense	probably benign	0.03
R5433:Szt2	UTSW	4	118375466	unclassified	probably benign
R5625:Szt2	UTSW	4	118373217	missense	unknown
R5628:Szt2	UTSW	4	118373217	missense	unknown
R5630:Szt2	UTSW	4	118392905	missense	possibly damaging	0.83
R5808:Szt2	UTSW	4	118372613	missense	unknown
R5902:Szt2	UTSW	4	118391503	missense	probably benign	0.05
R6049:Szt2	UTSW	4	118402988	missense	probably damaging	0.99
R6066:Szt2	UTSW	4	118371974	missense	unknown
R6272:Szt2	UTSW	4	118374290	unclassified	probably benign
R6456:Szt2	UTSW	4	118376697	unclassified	probably benign
R6538:Szt2	UTSW	4	118390477	splice site	probably null
R6604:Szt2	UTSW	4	118385474	missense	probably benign	0.01
R6664:Szt2	UTSW	4	118391745	missense	probably damaging	1.00
R6834:Szt2	UTSW	4	118388325	missense	probably benign	0.01
R7109:Szt2	UTSW	4	118375479	missense	unknown
R7163:Szt2	UTSW	4	118405530	missense	possibly damaging	0.90
R7190:Szt2	UTSW	4	118389006	missense	probably damaging	0.98
R7289:Szt2	UTSW	4	118375878	missense	unknown
R7291:Szt2	UTSW	4	118391249	missense	probably damaging	0.98
R7383:Szt2	UTSW	4	118365214	nonsense	probably null
R7448:Szt2	UTSW	4	118363471	missense	unknown
R7637:Szt2	UTSW	4	118393828	missense	probably damaging	0.99
R7833:Szt2	UTSW	4	118366219	missense	unknown
R7896:Szt2	UTSW	4	118402913	missense	possibly damaging	0.62
R7923:Szt2	UTSW	4	118373840	missense	unknown
R8090:Szt2	UTSW	4	118387002	splice site	probably null
R8103:Szt2	UTSW	4	118387864	missense	possibly damaging	0.88
R8288:Szt2	UTSW	4	118389776	missense	probably damaging	0.96
R8309:Szt2	UTSW	4	118375482	frame shift	probably null
R8341:Szt2	UTSW	4	118392836	missense	possibly damaging	0.63
R8480:Szt2	UTSW	4	118386818	missense	probably benign	0.01
R8497:Szt2	UTSW	4	118388321	missense	possibly damaging	0.94
R8549:Szt2	UTSW	4	118372681	missense	unknown
R8768:Szt2	UTSW	4	118369416	missense	unknown
R8992:Szt2	UTSW	4	118382788	splice site	probably benign
R9001:Szt2	UTSW	4	118378332	missense	unknown
R9094:Szt2	UTSW	4	118385454	missense	possibly damaging	0.74
R9110:Szt2	UTSW	4	118385433	missense	possibly damaging	0.89
R9129:Szt2	UTSW	4	118364669	missense	unknown
R9184:Szt2	UTSW	4	118384529	missense	possibly damaging	0.92
R9186:Szt2	UTSW	4	118385091	missense	probably damaging	1.00
R9424:Szt2	UTSW	4	118390954	missense	probably damaging	1.00
R9598:Szt2	UTSW	4	118409161	critical splice donor site	probably null
X0023:Szt2	UTSW	4	118372404	missense	unknown
Z1176:Szt2	UTSW	4	118393976	missense	probably damaging	0.99
Z1177:Szt2	UTSW	4	118391214	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTGTACTATGCTAATGTTCCCC -3'
(R):5'- CCAGGTGTAAGCAAGGCTTC -3'

Sequencing Primer
(F):5'- ATCCATCCTGAGCTGGAGG -3'
(R):5'- CTTTTTACCTCCAGGCTAGAGAG -3'

Posted On

2015-10-08