Mutagenetix > Incidental Mutation

Incidental Mutation 'R4670:Ift140'

348390

Institutional Source

Beutler Lab

Gene Symbol

Ift140

Ensembl Gene

ENSMUSG00000024169

Gene Name

intraflagellar transport 140

Synonyms

Tce5, Wdtc2

MMRRC Submission

041926-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4670 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

25016091-25099495 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to A at 25098961 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000024987] [ENSMUST00000115181]

AlphaFold

E9PY46

Predicted Effect

probably benign
Transcript: ENSMUST00000024983

SMART Domains

Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169

Domain	Start	End	E-Value	Type
WD40	55	89	6.14e1	SMART
WD40	91	131	1.49e0	SMART
Blast:WD40	252	304	3e-15	BLAST
WD40	308	352	2.76e0	SMART
Blast:WD40	364	405	8e-17	BLAST
Blast:WD40	510	547	6e-13	BLAST
Blast:WD40	560	603	3e-7	BLAST
Blast:TPR	863	896	9e-13	BLAST
Blast:TPR	1011	1044	1e-13	BLAST
Blast:TPR	1377	1410	8e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000024987

SMART Domains

Protein: ENSMUSP00000024987
Gene: ENSMUSG00000024170

Domain	Start	End	E-Value	Type
Pfam:Telomere_reg-2	513	621	3.8e-38	PFAM
low complexity region	771	782	N/A	INTRINSIC
low complexity region	816	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115181

SMART Domains

Protein: ENSMUSP00000110835
Gene: ENSMUSG00000024170

Domain	Start	End	E-Value	Type
Pfam:Telomere_reg-2	513	621	3.8e-38	PFAM
low complexity region	771	782	N/A	INTRINSIC
low complexity region	816	837	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142000

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143390

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153895

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155607

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155632

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156698

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (69/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm5	T	A	7: 119,531,760		probably null	Het
Alb	T	A	5: 90,462,806	S82T	probably benign	Het
Arf4	A	G	14: 26,653,093		probably benign	Het
Arhgap22	T	C	14: 33,362,543	C260R	probably damaging	Het
Arhgap32	A	G	9: 32,170,145	E153G	probably benign	Het
Arhgef18	T	A	8: 3,434,897	M200K	probably damaging	Het
Atp1a4	T	A	1: 172,235,000	N647Y	probably benign	Het
Atp5c1	A	T	2: 10,059,617	L226Q	probably damaging	Het
Bcas1	T	C	2: 170,384,325	K310R	probably damaging	Het
Cadm3	T	A	1: 173,346,446	T67S	probably damaging	Het
Cartpt	C	T	13: 99,900,080		probably null	Het
Cenpj	A	T	14: 56,553,383	V403E	possibly damaging	Het
Chst7	C	A	X: 20,060,871	R386S	probably damaging	Het
Cyp4f37	A	T	17: 32,625,152	M77L	probably benign	Het
Dnah7b	A	T	1: 46,078,524	D50V	probably damaging	Het
Galnt4	A	G	10: 99,109,298	D295G	possibly damaging	Het
Gin1	C	T	1: 97,784,840	P154S	probably damaging	Het
Gm6471	G	A	7: 142,831,623		noncoding transcript	Het
Gm6818	T	A	7: 38,402,557		noncoding transcript	Het
Gm9271	T	A	7: 39,364,310		noncoding transcript	Het
Gpam	A	G	19: 55,096,119		probably null	Het
Gpr183	T	C	14: 121,954,737	D124G	probably damaging	Het
Itih5	A	C	2: 10,190,369	I191L	probably benign	Het
Jcad	A	G	18: 4,674,175	T646A	probably benign	Het
Kank1	T	C	19: 25,410,580	M511T	probably benign	Het
Krt74	A	T	15: 101,758,869		noncoding transcript	Het
Lrrc37a	A	G	11: 103,504,537	S21P	probably benign	Het
Lrrc8c	G	A	5: 105,608,374	V672I	probably benign	Het
Lypd4	T	C	7: 24,866,726	R58G	probably benign	Het
Magi1	A	T	6: 93,686,643		probably null	Het
Mefv	T	A	16: 3,708,207	L745F	possibly damaging	Het
Myh13	A	T	11: 67,364,738	K1645*	probably null	Het
Naip6	A	G	13: 100,294,731		probably null	Het
Nlrp1c-ps	T	C	11: 71,280,556		noncoding transcript	Het
Nsmce3	A	T	7: 64,872,782	L46Q	probably benign	Het
Olfr1084	T	C	2: 86,639,168	D180G	possibly damaging	Het
Olfr231	T	A	1: 174,117,861	M52L	probably benign	Het
Olfr612	A	G	7: 103,539,186	V16A	possibly damaging	Het
P2ry12	T	C	3: 59,217,904		probably null	Het
Pcx	T	A	19: 4,619,888	V861E	probably damaging	Het
Pkp3	C	T	7: 141,082,699	P75S	probably benign	Het
Plscr4	T	C	9: 92,482,867		probably null	Het
Pole	A	G	5: 110,306,387	T923A	probably benign	Het
Ptgir	A	G	7: 16,906,869	M29V	possibly damaging	Het
Rhot2	A	C	17: 25,841,331		probably benign	Het
Rsrp1	A	G	4: 134,924,177	Y84C	unknown	Het
Sbf2	T	C	7: 110,335,399	K1348E	probably damaging	Het
Sgip1	A	T	4: 102,869,754	N53Y	probably damaging	Het
Snapc2	A	G	8: 4,254,998	T127A	possibly damaging	Het
Snx8	A	G	5: 140,355,958		probably null	Het
Spag8	A	G	4: 43,653,378		probably benign	Het
Srebf2	T	C	15: 82,192,302	F718L	probably damaging	Het
Szt2	C	G	4: 118,375,829		probably benign	Het
Traf3ip2	C	T	10: 39,639,260	P345S	possibly damaging	Het
Tubgcp4	T	A	2: 121,173,665	Y62*	probably null	Het
Usp29	T	A	7: 6,962,915	S586T	possibly damaging	Het
Vasp	T	C	7: 19,264,425	N108S	probably benign	Het
Vmn1r214	A	G	13: 23,034,971	M212V	probably benign	Het
Wipi2	G	C	5: 142,659,590	A194P	probably benign	Het
Zbtb4	T	A	11: 69,776,529	I220N	probably damaging	Het
Zcchc2	A	T	1: 105,990,266		probably benign	Het
Zfp729a	T	A	13: 67,621,415	K232*	probably null	Het
Zfp995	A	T	17: 21,887,339	M1K	probably null	Het

Other mutations in Ift140

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Ift140	APN	17	25055644	missense	probably damaging	1.00
IGL00966:Ift140	APN	17	25018802	missense	probably damaging	1.00
IGL01082:Ift140	APN	17	25048455	missense	possibly damaging	0.89
IGL01394:Ift140	APN	17	25094702	missense	probably benign	0.02
IGL01816:Ift140	APN	17	25087025	splice site	probably null
IGL01994:Ift140	APN	17	25048443	missense	probably damaging	1.00
IGL02102:Ift140	APN	17	25033130	missense	probably benign	0.03
IGL02207:Ift140	APN	17	25055598	missense	probably benign
IGL02493:Ift140	APN	17	25087924	nonsense	probably null
IGL02735:Ift140	APN	17	25034035	splice site	probably benign
IGL02902:Ift140	APN	17	25090762	missense	probably damaging	1.00
IGL03037:Ift140	APN	17	25092394	missense	probably benign	0.02
IGL03122:Ift140	APN	17	25086910	missense	probably damaging	1.00
IGL03206:Ift140	APN	17	25092826	missense	probably damaging	0.98
IGL03271:Ift140	APN	17	25087906	missense	probably damaging	1.00
IGL03358:Ift140	APN	17	25087984	missense	probably damaging	1.00
PIT4515001:Ift140	UTSW	17	25086860	missense	probably damaging	0.98
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0100:Ift140	UTSW	17	25090954	nonsense	probably null
R0197:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0238:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0239:Ift140	UTSW	17	25045523	nonsense	probably null
R0355:Ift140	UTSW	17	25048435	nonsense	probably null
R0399:Ift140	UTSW	17	25050340	missense	possibly damaging	0.77
R0574:Ift140	UTSW	17	25051760	splice site	probably null
R0610:Ift140	UTSW	17	25035803	missense	probably benign	0.06
R0701:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0883:Ift140	UTSW	17	25090933	missense	probably benign	0.09
R0900:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R1167:Ift140	UTSW	17	25035745	missense	probably benign	0.01
R1295:Ift140	UTSW	17	25088933	critical splice donor site	probably null
R1588:Ift140	UTSW	17	25087985	missense	probably damaging	1.00
R1619:Ift140	UTSW	17	25088865	missense	probably damaging	1.00
R1637:Ift140	UTSW	17	25025634	missense	probably benign	0.40
R1854:Ift140	UTSW	17	25035839	missense	probably benign	0.05
R2397:Ift140	UTSW	17	25020736	missense	probably damaging	1.00
R2510:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R2918:Ift140	UTSW	17	25035831	missense	possibly damaging	0.66
R3433:Ift140	UTSW	17	25036308	missense	probably benign	0.02
R3878:Ift140	UTSW	17	25028944	missense	probably benign	0.25
R4559:Ift140	UTSW	17	25090767	missense	probably damaging	0.97
R4711:Ift140	UTSW	17	25094717	splice site	probably null
R4934:Ift140	UTSW	17	25048488	missense	probably benign
R4949:Ift140	UTSW	17	25094665	missense	probably benign	0.06
R4982:Ift140	UTSW	17	25036994	missense	probably damaging	0.99
R5099:Ift140	UTSW	17	25090700	missense	probably damaging	1.00
R5223:Ift140	UTSW	17	25035812	missense	probably benign	0.22
R5268:Ift140	UTSW	17	25020627	missense	possibly damaging	0.48
R5423:Ift140	UTSW	17	25033085	missense	probably damaging	0.96
R5480:Ift140	UTSW	17	25020576	missense	probably damaging	1.00
R5655:Ift140	UTSW	17	25045064	missense	probably damaging	1.00
R5756:Ift140	UTSW	17	25028813	missense	possibly damaging	0.62
R5837:Ift140	UTSW	17	25089540	missense	probably damaging	1.00
R5894:Ift140	UTSW	17	25033919	missense	possibly damaging	0.92
R5907:Ift140	UTSW	17	25092371	missense	probably benign	0.02
R5966:Ift140	UTSW	17	25094761	nonsense	probably null
R6000:Ift140	UTSW	17	25036960	missense	probably benign	0.00
R6046:Ift140	UTSW	17	25055589	missense	probably benign	0.00
R6050:Ift140	UTSW	17	25091005	missense	probably damaging	1.00
R6103:Ift140	UTSW	17	25093126	missense	probably damaging	1.00
R6239:Ift140	UTSW	17	25028972	missense	probably benign	0.26
R6287:Ift140	UTSW	17	25050434	missense	probably benign
R6539:Ift140	UTSW	17	25094669	missense	possibly damaging	0.87
R6656:Ift140	UTSW	17	25032173	missense	probably damaging	0.96
R6723:Ift140	UTSW	17	25033116	missense	probably benign	0.08
R6749:Ift140	UTSW	17	25098916	missense	probably damaging	0.99
R6892:Ift140	UTSW	17	25020546	missense	possibly damaging	0.95
R7151:Ift140	UTSW	17	25055725	missense	probably damaging	1.00
R7235:Ift140	UTSW	17	25020645	missense	possibly damaging	0.88
R7424:Ift140	UTSW	17	25037036	missense	possibly damaging	0.81
R7552:Ift140	UTSW	17	25033115	missense	probably benign	0.02
R7560:Ift140	UTSW	17	25092341	missense	probably benign	0.28
R7660:Ift140	UTSW	17	25051824	missense	probably damaging	1.00
R8105:Ift140	UTSW	17	25036975	missense	probably benign	0.01
R8415:Ift140	UTSW	17	25092915	missense	probably damaging	0.99
R8437:Ift140	UTSW	17	25094677	missense	probably damaging	0.99
R8747:Ift140	UTSW	17	25035835	missense	probably benign
R8932:Ift140	UTSW	17	25086888	missense	probably benign	0.03
R9226:Ift140	UTSW	17	25098865	missense	probably benign	0.00
R9347:Ift140	UTSW	17	25094779	missense	probably benign	0.00
R9451:Ift140	UTSW	17	25033951	missense	probably benign	0.33
R9456:Ift140	UTSW	17	25035784	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TACTATGTGGACCAGCGCAC -3'
(R):5'- GCAGCTCATGTCACAAAGTTC -3'

Sequencing Primer
(F):5'- AGCGCACTGTGGACACTG -3'
(R):5'- CCGCTCTTGCTTACAATG -3'

Posted On

2015-10-08