Incidental Mutation 'R4671:Sell'
ID348402
Institutional Source Beutler Lab
Gene Symbol Sell
Ensembl Gene ENSMUSG00000026581
Gene Nameselectin, lymphocyte
SynonymsLyam1, CD62L, L-selectin, Ly-m22, LECAM-1, Lyam-1, Ly-22, Lnhr
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location164061982-164084181 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 164065473 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 86 (Y86C)
Ref Sequence ENSEMBL: ENSMUSP00000142237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027871] [ENSMUST00000097491] [ENSMUST00000192047] [ENSMUST00000195358]
Predicted Effect probably damaging
Transcript: ENSMUST00000027871
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027871
Gene: ENSMUSG00000026581
AA Change: Y86C

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
EGF 159 192 6.55e-1 SMART
CCP 197 254 1.09e-11 SMART
CCP 259 316 1.09e-11 SMART
transmembrane domain 333 355 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097491
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095099
Gene: ENSMUSG00000026581
AA Change: Y86C

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192047
AA Change: Y86C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142237
Gene: ENSMUSG00000026581
AA Change: Y86C

DomainStartEndE-ValueType
CLECT 27 156 1.14e-19 SMART
CCP 161 218 1.09e-11 SMART
CCP 223 280 1.09e-11 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195358
SMART Domains Protein: ENSMUSP00000141365
Gene: ENSMUSG00000026581

DomainStartEndE-ValueType
Pfam:Sushi 1 31 1.3e-4 PFAM
transmembrane domain 48 70 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface adhesion molecule that belongs to a family of adhesion/homing receptors. The encoded protein contains a C-type lectin-like domain, a calcium-binding epidermal growth factor-like domain, and two short complement-like repeats. The gene product is required for binding and subsequent rolling of leucocytes on endothelial cells, facilitating their migration into secondary lymphoid organs and inflammation sites. Single-nucleotide polymorphisms in this gene have been associated with various diseases including immunoglobulin A nephropathy. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit lack of lymphocyte binding to high endothelial venules of peripheral lymph nodes and defects in leukocyte rolling and neutrophil migration into the peritoneum following an inflammatory stimulus. Tumor cellsurvival is also reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Sell
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01981:Sell APN 1 164065626 missense probably benign 0.04
IGL02466:Sell APN 1 164069063 splice site probably null
IGL02578:Sell APN 1 164065596 missense probably damaging 1.00
IGL03243:Sell APN 1 164065342 missense possibly damaging 0.94
dim_sum UTSW 1 164066201 unclassified probably null
dim_sum2 UTSW 1 164065661 nonsense probably null
R0125:Sell UTSW 1 164072105 splice site probably benign
R0800:Sell UTSW 1 164066201 unclassified probably null
R1900:Sell UTSW 1 164065338 missense probably damaging 1.00
R3848:Sell UTSW 1 164065661 nonsense probably null
R4553:Sell UTSW 1 164072116 missense probably benign 0.08
R4685:Sell UTSW 1 164066260 missense probably damaging 1.00
R4896:Sell UTSW 1 164063062 missense probably benign 0.02
R4970:Sell UTSW 1 164065318 missense possibly damaging 0.75
R5112:Sell UTSW 1 164065318 missense possibly damaging 0.75
R6549:Sell UTSW 1 164065629 missense probably damaging 1.00
R7148:Sell UTSW 1 164065607 missense possibly damaging 0.85
R7545:Sell UTSW 1 164065334 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTCCAGACTTCCTGATACACCATG -3'
(R):5'- ACTGCCTACCTGTGTAGCAG -3'

Sequencing Primer
(F):5'- ACCATGGAACTCACTGTTGG -3'
(R):5'- GACAGGCGTCATCGTTCCATTTC -3'
Posted On2015-10-08