Incidental Mutation 'R4671:Mast2'
ID348414
Institutional Source Beutler Lab
Gene Symbol Mast2
Ensembl Gene ENSMUSG00000003810
Gene Namemicrotubule associated serine/threonine kinase 2
SynonymsMAST205, Mtssk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116306762-116464183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116308650 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1287 (S1287P)
Ref Sequence ENSEMBL: ENSMUSP00000102094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003908] [ENSMUST00000106484] [ENSMUST00000106485] [ENSMUST00000106486]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003908
AA Change: S1226P

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003908
Gene: ENSMUSG00000003810
AA Change: S1226P

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 416 1.8e-148 PFAM
S_TKc 452 725 2.96e-99 SMART
S_TK_X 726 786 1.08e-1 SMART
low complexity region 849 861 N/A INTRINSIC
low complexity region 1009 1028 N/A INTRINSIC
PDZ 1049 1129 2.23e-12 SMART
low complexity region 1142 1157 N/A INTRINSIC
low complexity region 1177 1210 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
low complexity region 1279 1302 N/A INTRINSIC
low complexity region 1345 1360 N/A INTRINSIC
low complexity region 1437 1452 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106484
AA Change: S1233P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102093
Gene: ENSMUSG00000003810
AA Change: S1233P

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
low complexity region 56 63 N/A INTRINSIC
Pfam:DUF1908 141 423 1.3e-151 PFAM
S_TKc 459 732 2.96e-99 SMART
S_TK_X 733 793 1.08e-1 SMART
low complexity region 856 868 N/A INTRINSIC
low complexity region 1016 1035 N/A INTRINSIC
PDZ 1056 1136 2.23e-12 SMART
low complexity region 1149 1164 N/A INTRINSIC
low complexity region 1184 1217 N/A INTRINSIC
low complexity region 1233 1255 N/A INTRINSIC
low complexity region 1285 1308 N/A INTRINSIC
low complexity region 1351 1366 N/A INTRINSIC
low complexity region 1443 1458 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106485
AA Change: S1287P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102094
Gene: ENSMUSG00000003810
AA Change: S1287P

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 477 1.1e-148 PFAM
S_TKc 513 786 2.96e-99 SMART
S_TK_X 787 847 1.08e-1 SMART
low complexity region 910 922 N/A INTRINSIC
low complexity region 1070 1089 N/A INTRINSIC
PDZ 1110 1190 2.23e-12 SMART
low complexity region 1203 1218 N/A INTRINSIC
low complexity region 1238 1271 N/A INTRINSIC
low complexity region 1285 1310 N/A INTRINSIC
low complexity region 1340 1363 N/A INTRINSIC
low complexity region 1406 1421 N/A INTRINSIC
low complexity region 1498 1513 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106486
AA Change: S1294P

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102095
Gene: ENSMUSG00000003810
AA Change: S1294P

DomainStartEndE-ValueType
low complexity region 7 26 N/A INTRINSIC
low complexity region 27 41 N/A INTRINSIC
low complexity region 99 110 N/A INTRINSIC
low complexity region 117 124 N/A INTRINSIC
Pfam:DUF1908 202 483 2.9e-143 PFAM
S_TKc 520 793 2.96e-99 SMART
S_TK_X 794 854 1.08e-1 SMART
low complexity region 917 929 N/A INTRINSIC
low complexity region 1077 1096 N/A INTRINSIC
PDZ 1117 1197 2.23e-12 SMART
low complexity region 1210 1225 N/A INTRINSIC
low complexity region 1245 1278 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1346 1369 N/A INTRINSIC
low complexity region 1412 1427 N/A INTRINSIC
low complexity region 1504 1519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128713
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156884
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: No phenotype has been reported for a gene trap strain; however, it is not yet known whether the gene trap insertion affects expression of the gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Mast2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Mast2 APN 4 116311329 missense probably benign 0.39
IGL00916:Mast2 APN 4 116327633 missense possibly damaging 0.88
IGL02112:Mast2 APN 4 116319764 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116307987 missense probably damaging 1.00
R0645:Mast2 UTSW 4 116312846 splice site probably benign
R0883:Mast2 UTSW 4 116311767 missense probably damaging 1.00
R1447:Mast2 UTSW 4 116312013 missense probably benign 0.02
R1449:Mast2 UTSW 4 116309013 missense probably damaging 1.00
R1473:Mast2 UTSW 4 116311955 missense probably damaging 1.00
R1491:Mast2 UTSW 4 116316491 missense possibly damaging 0.90
R1529:Mast2 UTSW 4 116430519 missense probably benign 0.17
R1654:Mast2 UTSW 4 116316550 critical splice acceptor site probably null
R1768:Mast2 UTSW 4 116306959 missense probably damaging 1.00
R1807:Mast2 UTSW 4 116310741 splice site probably benign
R1981:Mast2 UTSW 4 116314840 missense probably damaging 1.00
R2081:Mast2 UTSW 4 116330474 splice site probably null
R2157:Mast2 UTSW 4 116322283 missense probably damaging 1.00
R3409:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3411:Mast2 UTSW 4 116310910 missense possibly damaging 0.94
R3434:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3435:Mast2 UTSW 4 116308095 missense probably benign 0.00
R3953:Mast2 UTSW 4 116313729 missense probably damaging 1.00
R4056:Mast2 UTSW 4 116337501 splice site probably benign
R4153:Mast2 UTSW 4 116315963 missense possibly damaging 0.91
R4648:Mast2 UTSW 4 116314839 nonsense probably null
R4911:Mast2 UTSW 4 116353057 missense probably benign 0.36
R4980:Mast2 UTSW 4 116317751 missense probably damaging 1.00
R5322:Mast2 UTSW 4 116333411 critical splice donor site probably null
R5462:Mast2 UTSW 4 116307458 missense probably damaging 0.99
R5586:Mast2 UTSW 4 116435563 missense probably damaging 0.99
R5750:Mast2 UTSW 4 116308889 intron probably benign
R5771:Mast2 UTSW 4 116333425 missense possibly damaging 0.60
R5885:Mast2 UTSW 4 116314838 missense probably damaging 1.00
R6230:Mast2 UTSW 4 116326098 missense probably damaging 1.00
R6347:Mast2 UTSW 4 116317732 missense probably damaging 1.00
R6527:Mast2 UTSW 4 116314939 missense probably damaging 0.99
R6619:Mast2 UTSW 4 116316497 nonsense probably null
R7070:Mast2 UTSW 4 116310855 missense probably benign 0.03
R7303:Mast2 UTSW 4 116308311 missense possibly damaging 0.63
R7822:Mast2 UTSW 4 116312873 missense probably damaging 1.00
R7843:Mast2 UTSW 4 116353011 missense probably damaging 0.98
R7918:Mast2 UTSW 4 116435535 missense possibly damaging 0.50
R7939:Mast2 UTSW 4 116430471 missense probably benign 0.09
R8052:Mast2 UTSW 4 116312975 missense probably damaging 0.99
R8115:Mast2 UTSW 4 116435447 missense probably benign 0.01
R8312:Mast2 UTSW 4 116430486 missense probably benign
R8398:Mast2 UTSW 4 116308749 missense probably damaging 1.00
R8477:Mast2 UTSW 4 116307210 missense probably benign 0.43
R8759:Mast2 UTSW 4 116435560 missense possibly damaging 0.80
R8832:Mast2 UTSW 4 116311678 critical splice donor site probably null
X0003:Mast2 UTSW 4 116307647 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAATGCCCCAAGACTGCTG -3'
(R):5'- GAAGCTCCCTATTCCGGAAAATC -3'

Sequencing Primer
(F):5'- ACTGGTGACTACAGTCCACTTAATC -3'
(R):5'- TCACAAAGCAGGCCTCCTTG -3'
Posted On2015-10-08