Incidental Mutation 'R0265:Alox5'
ID34846
Institutional Source Beutler Lab
Gene Symbol Alox5
Ensembl Gene ENSMUSG00000025701
Gene Namearachidonate 5-lipoxygenase
Synonyms5LO, 5-LOX, 5LX
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R0265 (G1)
Quality Score210
Status Validated
Chromosome6
Chromosomal Location116410077-116461178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116420362 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 287 (Y287C)
Ref Sequence ENSEMBL: ENSMUSP00000130780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203722]
Predicted Effect probably benign
Transcript: ENSMUST00000026795
AA Change: Y287C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: Y287C

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 212 662 1.5e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164547
AA Change: Y287C

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: Y287C

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 125 217 5.1e-12 PFAM
Pfam:Lipoxygenase 213 564 8.4e-133 PFAM
Pfam:Lipoxygenase 558 609 7.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167447
Predicted Effect probably benign
Transcript: ENSMUST00000170186
AA Change: Y287C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: Y287C

DomainStartEndE-ValueType
LH2 2 115 3.41e-39 SMART
Pfam:Lipoxygenase 150 220 1.9e-13 PFAM
Pfam:Lipoxygenase 215 432 8.6e-79 PFAM
Pfam:Lipoxygenase 426 634 1e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203722
AA Change: Y287C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701
AA Change: Y287C

DomainStartEndE-ValueType
LH2 2 115 2.2e-41 SMART
Pfam:Lipoxygenase 213 430 3e-35 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Alox5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Alox5 APN 6 116415517 missense probably damaging 1.00
IGL00954:Alox5 APN 6 116454299 missense probably damaging 1.00
IGL01610:Alox5 APN 6 116413547 missense probably damaging 1.00
IGL02161:Alox5 APN 6 116423193 missense probably benign 0.31
IGL02653:Alox5 APN 6 116415477 missense probably benign 0.41
IGL02903:Alox5 APN 6 116420335 missense probably damaging 1.00
clanger UTSW 6 116414595 missense probably damaging 1.00
Triangle UTSW 6 116427137 splice site probably null
R0347:Alox5 UTSW 6 116413552 missense possibly damaging 0.88
R0543:Alox5 UTSW 6 116454317 critical splice acceptor site probably null
R0633:Alox5 UTSW 6 116420384 missense probably damaging 1.00
R0656:Alox5 UTSW 6 116423330 splice site probably benign
R1298:Alox5 UTSW 6 116427264 missense probably damaging 1.00
R1416:Alox5 UTSW 6 116423145 nonsense probably null
R1484:Alox5 UTSW 6 116454167 missense probably damaging 1.00
R1485:Alox5 UTSW 6 116424164 missense probably damaging 1.00
R1518:Alox5 UTSW 6 116413780 missense probably damaging 0.99
R1993:Alox5 UTSW 6 116415463 missense probably damaging 1.00
R2313:Alox5 UTSW 6 116413861 missense probably benign 0.00
R3125:Alox5 UTSW 6 116427137 splice site probably null
R4042:Alox5 UTSW 6 116461018 missense possibly damaging 0.95
R4092:Alox5 UTSW 6 116412674 intron probably benign
R4356:Alox5 UTSW 6 116420258 missense probably benign 0.05
R4367:Alox5 UTSW 6 116460963 missense possibly damaging 0.86
R4690:Alox5 UTSW 6 116423189 missense probably damaging 1.00
R4792:Alox5 UTSW 6 116461003 missense possibly damaging 0.94
R4873:Alox5 UTSW 6 116413850 splice site probably null
R4875:Alox5 UTSW 6 116413850 splice site probably null
R5135:Alox5 UTSW 6 116413786 missense probably benign 0.00
R5242:Alox5 UTSW 6 116460966 missense probably damaging 0.97
R5343:Alox5 UTSW 6 116413507 missense possibly damaging 0.95
R5780:Alox5 UTSW 6 116420349 missense probably benign 0.10
R6348:Alox5 UTSW 6 116414595 missense probably damaging 1.00
R6724:Alox5 UTSW 6 116414548 missense probably damaging 1.00
R6769:Alox5 UTSW 6 116415184 splice site probably null
R6954:Alox5 UTSW 6 116420280 nonsense probably null
R7102:Alox5 UTSW 6 116413468 missense probably benign 0.01
R7476:Alox5 UTSW 6 116415433 missense probably benign 0.06
R7626:Alox5 UTSW 6 116413795 missense possibly damaging 0.94
R7690:Alox5 UTSW 6 116415456 missense probably damaging 1.00
R7912:Alox5 UTSW 6 116412536 missense probably benign 0.05
R8234:Alox5 UTSW 6 116413874 missense probably damaging 0.98
R8701:Alox5 UTSW 6 116413826 missense possibly damaging 0.47
R8787:Alox5 UTSW 6 116413141 missense probably damaging 0.99
R8910:Alox5 UTSW 6 116412549 nonsense probably null
X0028:Alox5 UTSW 6 116424154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCTAGAGGTACAAGTCGTACAG -3'
(R):5'- ACAGACTCTTCCAGTGACCAGCAG -3'

Sequencing Primer
(F):5'- TACAAGTCGTACAGAAGGGCTG -3'
(R):5'- TGGTCACATGAAGAATCGTCC -3'
Posted On2013-05-09