Mutagenetix > Incidental Mutation

Incidental Mutation 'R0265:Alox5'

34846

Institutional Source

Beutler Lab

Gene Symbol

Alox5

Ensembl Gene

ENSMUSG00000025701

Gene Name

arachidonate 5-lipoxygenase

Synonyms

5LO, 5-LOX, 5LX

MMRRC Submission

038491-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R0265 (G1)

Quality Score

210

Status

Validated

Chromosome

Chromosomal Location

116410077-116461178 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 116420362 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 287 (Y287C)

Ref Sequence

ENSEMBL: ENSMUSP00000130780 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026795] [ENSMUST00000164547] [ENSMUST00000170186] [ENSMUST00000203722]

AlphaFold

P48999

Predicted Effect

probably benign
Transcript: ENSMUST00000026795
AA Change: Y287C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000026795
Gene: ENSMUSG00000025701
AA Change: Y287C

Domain	Start	End	E-Value	Type
LH2	2	115	3.41e-39	SMART
Pfam:Lipoxygenase	212	662	1.5e-79	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000164547
AA Change: Y287C

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000130780
Gene: ENSMUSG00000025701
AA Change: Y287C

Domain	Start	End	E-Value	Type
LH2	2	115	3.41e-39	SMART
Pfam:Lipoxygenase	125	217	5.1e-12	PFAM
Pfam:Lipoxygenase	213	564	8.4e-133	PFAM
Pfam:Lipoxygenase	558	609	7.3e-10	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167174

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167447

Predicted Effect

probably benign
Transcript: ENSMUST00000170186
AA Change: Y287C

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000130424
Gene: ENSMUSG00000025701
AA Change: Y287C

Domain	Start	End	E-Value	Type
LH2	2	115	3.41e-39	SMART
Pfam:Lipoxygenase	150	220	1.9e-13	PFAM
Pfam:Lipoxygenase	215	432	8.6e-79	PFAM
Pfam:Lipoxygenase	426	634	1e-73	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203722
AA Change: Y287C

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000145367
Gene: ENSMUSG00000025701
AA Change: Y287C

Domain	Start	End	E-Value	Type
LH2	2	115	2.2e-41	SMART
Pfam:Lipoxygenase	213	430	3e-35	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.6%
20x: 92.0%

Validation Efficiency

99% (83/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lipoxygenase gene family and plays a dual role in the synthesis of leukotrienes from arachidonic acid. The encoded protein, which is expressed specifically in bone marrow-derived cells, catalyzes the conversion of arachidonic acid to 5(S)-hydroperoxy-6-trans-8,11,14-cis-eicosatetraenoic acid, and further to the allylic epoxide 5(S)-trans-7,9-trans-11,14-cis-eicosatetrenoic acid (leukotriene A4). Leukotrienes are important mediators of a number of inflammatory and allergic conditions. Mutations in the promoter region of this gene lead to a diminished response to antileukotriene drugs used in the treatment of asthma and may also be associated with atherosclerosis and several cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Nullizygous mice show altered inflammatory responses. One null mutation causes resistance to lethal anaphylaxis, abnormal eicosanoid production and neutrophil recruitment while another leads to increased body fat, bone density, leptin and VLDL cholesterol levels and resistance to autoimmune uveitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930452B06Rik	T	G	14: 8,431,667	Y655S	probably damaging	Het
9330182L06Rik	T	C	5: 9,434,681	L486P	probably damaging	Het
Abca14	A	G	7: 120,223,627	I321V	probably benign	Het
Adcy7	A	G	8: 88,324,763	D837G	probably damaging	Het
Aldh1a1	T	A	19: 20,640,076	Y457*	probably null	Het
Ano8	T	C	8: 71,480,524		probably benign	Het
Ap3b1	A	G	13: 94,493,681	K815E	unknown	Het
Atp11a	A	T	8: 12,856,930		probably benign	Het
Atp6v0a1	A	T	11: 101,048,515	D702V	possibly damaging	Het
Cacna1b	T	A	2: 24,761,844	N108Y	probably damaging	Het
Ccdc57	G	C	11: 120,921,811	A39G	probably benign	Het
Cdhr1	A	T	14: 37,081,376	V581D	probably benign	Het
Cyp2b23	A	G	7: 26,672,879		probably benign	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Ddit4l	C	T	3: 137,624,287		probably benign	Het
Dnah8	A	T	17: 30,690,271	I1024F	probably benign	Het
Edc3	T	A	9: 57,727,338	F213I	probably damaging	Het
Edrf1	G	A	7: 133,657,045	D717N	probably damaging	Het
Efna5	G	A	17: 62,651,073	P63S	probably damaging	Het
Entpd3	A	G	9: 120,558,481	Y248C	probably damaging	Het
Flcn	G	A	11: 59,795,809	Q373*	probably null	Het
Fry	T	C	5: 150,434,776	V1908A	probably damaging	Het
Gabrg3	A	T	7: 57,381,617	Y58*	probably null	Het
Gabrp	A	T	11: 33,552,614	Y417N	probably damaging	Het
Golga2	C	A	2: 32,304,952		probably null	Het
Grip2	C	A	6: 91,773,792		probably null	Het
Gsx2	A	G	5: 75,077,068	Y227C	probably damaging	Het
Hif3a	T	C	7: 17,035,868	*665W	probably null	Het
Hist1h2aa	T	C	13: 23,934,649	V63A	probably benign	Het
Hsd3b1	C	A	3: 98,852,773	V301L	probably damaging	Het
Ifitm5	T	C	7: 140,950,008		probably benign	Het
Inpp4a	A	T	1: 37,378,986	D498V	probably damaging	Het
Itga1	A	T	13: 114,992,459	D554E	probably benign	Het
Itk	G	A	11: 46,389,458		probably benign	Het
Kdm3b	T	A	18: 34,795,663		probably benign	Het
Klhl6	A	G	16: 19,948,234	V470A	probably benign	Het
Lamb3	T	A	1: 193,320,531	W95R	probably damaging	Het
Lbhd2	T	A	12: 111,410,242	I41N	probably damaging	Het
Lrp4	A	T	2: 91,490,670	S1014C	probably damaging	Het
Ltbp2	C	T	12: 84,785,969		probably null	Het
Map3k19	A	G	1: 127,822,182	I1144T	possibly damaging	Het
Mfsd10	T	C	5: 34,635,163		probably benign	Het
Mocos	A	G	18: 24,666,276	D189G	probably benign	Het
Mvb12a	T	A	8: 71,547,010	F224L	probably damaging	Het
Myo15	A	T	11: 60,514,897		probably null	Het
Nos2	A	T	11: 78,937,602	H249L	probably damaging	Het
Notum	A	G	11: 120,658,334	M184T	probably benign	Het
Nvl	C	A	1: 181,134,830	D192Y	probably damaging	Het
Olfr1024	T	A	2: 85,904,247	N269I	probably benign	Het
Olfr1065	C	A	2: 86,445,959	V8L	probably benign	Het
Olfr1308	T	C	2: 111,960,494	Y193C	probably damaging	Het
Olfr204	A	T	16: 59,315,071	F112Y	probably damaging	Het
Olfr218	A	G	1: 173,203,917	K187R	probably benign	Het
Osgin1	A	G	8: 119,445,657	I397V	possibly damaging	Het
Otulin	A	G	15: 27,616,424	V123A	probably damaging	Het
P4ha1	A	G	10: 59,348,259	Y181C	probably damaging	Het
Pcdhgc5	A	T	18: 37,821,350	D559V	probably damaging	Het
Phf2	T	C	13: 48,828,794	N151S	unknown	Het
Plxnc1	C	A	10: 94,813,129	G1263C	probably benign	Het
Rad51ap1	A	G	6: 126,924,197	*338Q	probably null	Het
Raver1	A	G	9: 21,075,659	S676P	probably benign	Het
Rfx8	T	C	1: 39,688,577	E196G	possibly damaging	Het
Rreb1	A	T	13: 37,916,155	K187*	probably null	Het
Rxfp1	T	C	3: 79,667,654	T217A	probably benign	Het
Rxra	T	C	2: 27,752,430	L305P	probably damaging	Het
Sardh	T	C	2: 27,227,066		probably benign	Het
Skor2	A	T	18: 76,876,598	E952D	probably damaging	Het
Slc22a29	A	T	19: 8,169,970	S343T	probably benign	Het
Sorbs2	T	C	8: 45,785,337		probably benign	Het
Supt7l	C	T	5: 31,515,918	V329I	probably benign	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Tac1	T	C	6: 7,559,165		probably benign	Het
Tcn2	A	T	11: 3,922,044	V361D	probably damaging	Het
Tm2d3	G	A	7: 65,697,834	A170T	possibly damaging	Het
Tnks	G	A	8: 34,839,970	R1142*	probably null	Het
Ttll7	C	A	3: 146,944,160	Y648*	probably null	Het
Umod	G	T	7: 119,466,073	Q578K	probably benign	Het
Upf2	G	A	2: 6,027,204		probably benign	Het
Vmn2r92	C	T	17: 18,167,957	A408V	probably damaging	Het
Washc5	A	G	15: 59,338,960	I1013T	probably benign	Het
Wdr60	T	C	12: 116,257,406		probably benign	Het
Zfp704	C	A	3: 9,565,157	R48L	probably damaging	Het

Other mutations in Alox5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00331:Alox5	APN	6	116415517	missense	probably damaging	1.00
IGL00954:Alox5	APN	6	116454299	missense	probably damaging	1.00
IGL01610:Alox5	APN	6	116413547	missense	probably damaging	1.00
IGL02161:Alox5	APN	6	116423193	missense	probably benign	0.31
IGL02653:Alox5	APN	6	116415477	missense	probably benign	0.41
IGL02903:Alox5	APN	6	116420335	missense	probably damaging	1.00
clanger	UTSW	6	116414595	missense	probably damaging	1.00
nova	UTSW	6	116412549	nonsense	probably null
timpani	UTSW	6	116415456	missense	probably damaging	1.00
Triangle	UTSW	6	116427137	splice site	probably null
R0347:Alox5	UTSW	6	116413552	missense	possibly damaging	0.88
R0543:Alox5	UTSW	6	116454317	critical splice acceptor site	probably null
R0633:Alox5	UTSW	6	116420384	missense	probably damaging	1.00
R0656:Alox5	UTSW	6	116423330	splice site	probably benign
R1298:Alox5	UTSW	6	116427264	missense	probably damaging	1.00
R1416:Alox5	UTSW	6	116423145	nonsense	probably null
R1484:Alox5	UTSW	6	116454167	missense	probably damaging	1.00
R1485:Alox5	UTSW	6	116424164	missense	probably damaging	1.00
R1518:Alox5	UTSW	6	116413780	missense	probably damaging	0.99
R1993:Alox5	UTSW	6	116415463	missense	probably damaging	1.00
R2313:Alox5	UTSW	6	116413861	missense	probably benign	0.00
R3125:Alox5	UTSW	6	116427137	splice site	probably null
R4042:Alox5	UTSW	6	116461018	missense	possibly damaging	0.95
R4092:Alox5	UTSW	6	116412674	intron	probably benign
R4356:Alox5	UTSW	6	116420258	missense	probably benign	0.05
R4367:Alox5	UTSW	6	116460963	missense	possibly damaging	0.86
R4690:Alox5	UTSW	6	116423189	missense	probably damaging	1.00
R4792:Alox5	UTSW	6	116461003	missense	possibly damaging	0.94
R4873:Alox5	UTSW	6	116413850	splice site	probably null
R4875:Alox5	UTSW	6	116413850	splice site	probably null
R5135:Alox5	UTSW	6	116413786	missense	probably benign	0.00
R5242:Alox5	UTSW	6	116460966	missense	probably damaging	0.97
R5343:Alox5	UTSW	6	116413507	missense	possibly damaging	0.95
R5780:Alox5	UTSW	6	116420349	missense	probably benign	0.10
R6348:Alox5	UTSW	6	116414595	missense	probably damaging	1.00
R6724:Alox5	UTSW	6	116414548	missense	probably damaging	1.00
R6769:Alox5	UTSW	6	116415184	splice site	probably null
R6954:Alox5	UTSW	6	116420280	nonsense	probably null
R7102:Alox5	UTSW	6	116413468	missense	probably benign	0.01
R7476:Alox5	UTSW	6	116415433	missense	probably benign	0.06
R7626:Alox5	UTSW	6	116413795	missense	possibly damaging	0.94
R7690:Alox5	UTSW	6	116415456	missense	probably damaging	1.00
R7912:Alox5	UTSW	6	116412536	missense	probably benign	0.05
R8234:Alox5	UTSW	6	116413874	missense	probably damaging	0.98
R8701:Alox5	UTSW	6	116413826	missense	possibly damaging	0.47
R8787:Alox5	UTSW	6	116413141	missense	probably damaging	0.99
R8910:Alox5	UTSW	6	116412549	nonsense	probably null
R9708:Alox5	UTSW	6	116415576	missense	probably damaging	1.00
X0028:Alox5	UTSW	6	116424154	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCCTAGAGGTACAAGTCGTACAG -3'
(R):5'- ACAGACTCTTCCAGTGACCAGCAG -3'

Sequencing Primer
(F):5'- TACAAGTCGTACAGAAGGGCTG -3'
(R):5'- TGGTCACATGAAGAATCGTCC -3'

Posted On

2013-05-09