Incidental Mutation 'R4671:Acod1'
ID348461
Institutional Source Beutler Lab
Gene Symbol Acod1
Ensembl Gene ENSMUSG00000022126
Gene Nameaconitate decarboxylase 1
SynonymsIrg1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location103046977-103056573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 103047072 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 2 (M2R)
Ref Sequence ENSEMBL: ENSMUSP00000022722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022722]
Predicted Effect probably benign
Transcript: ENSMUST00000022722
AA Change: M2R

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022722
Gene: ENSMUSG00000022126
AA Change: M2R

DomainStartEndE-ValueType
Pfam:MmgE_PrpD 7 450 1.8e-125 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: LPS-stimulated bone marrow macrophages derived from homozygous null mice fail to produce itaconate and exhibit significantly decreased succinate accumulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lipf T G 19: 33,976,676 V389G possibly damaging Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Acod1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01368:Acod1 APN 14 103051334 missense probably damaging 1.00
IGL01450:Acod1 APN 14 103051483 missense possibly damaging 0.77
IGL01624:Acod1 APN 14 103055233 missense probably benign 0.03
IGL03323:Acod1 APN 14 103055294 missense probably damaging 1.00
R0049:Acod1 UTSW 14 103055207 missense possibly damaging 0.94
R0049:Acod1 UTSW 14 103055207 missense possibly damaging 0.94
R0304:Acod1 UTSW 14 103054982 missense probably damaging 0.97
R0321:Acod1 UTSW 14 103055129 missense probably benign 0.13
R0520:Acod1 UTSW 14 103051516 missense possibly damaging 0.78
R1467:Acod1 UTSW 14 103054567 missense probably benign 0.00
R1467:Acod1 UTSW 14 103054567 missense probably benign 0.00
R1541:Acod1 UTSW 14 103049333 missense probably damaging 0.98
R2511:Acod1 UTSW 14 103051339 missense probably damaging 1.00
R3856:Acod1 UTSW 14 103055446 missense possibly damaging 0.92
R4616:Acod1 UTSW 14 103055345 missense probably benign 0.10
R5080:Acod1 UTSW 14 103049308 missense possibly damaging 0.83
R5206:Acod1 UTSW 14 103055295 missense possibly damaging 0.90
R5992:Acod1 UTSW 14 103055035 missense probably damaging 1.00
R7228:Acod1 UTSW 14 103049329 missense probably benign 0.04
R7585:Acod1 UTSW 14 103054741 nonsense probably null
R7762:Acod1 UTSW 14 103051340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCCGCTGTAACACCTC -3'
(R):5'- CAATGGGATCATGGGCATTG -3'

Sequencing Primer
(F):5'- GCCCTACATCTATAAGGGAGCTC -3'
(R):5'- CATGGGCATTGTCTGTCAAATACTG -3'
Posted On2015-10-08