Incidental Mutation 'R4671:Lipf'
ID348476
Institutional Source Beutler Lab
Gene Symbol Lipf
Ensembl Gene ENSMUSG00000024768
Gene Namelipase, gastric
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R4671 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location33961187-33976810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33976676 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 389 (V389G)
Ref Sequence ENSEMBL: ENSMUSP00000025680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025680
AA Change: V389G

PolyPhen 2 Score 0.943 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025680
Gene: ENSMUSG00000024768
AA Change: V389G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Abhydro_lipase 34 96 2.9e-27 PFAM
Pfam:Abhydrolase_1 77 377 2.3e-26 PFAM
Pfam:Abhydrolase_5 78 372 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,718,859 I637V probably benign Het
Abcc2 T C 19: 43,800,718 S271P probably benign Het
Acod1 T G 14: 103,047,072 M2R probably benign Het
Adamts20 T C 15: 94,403,325 E106G possibly damaging Het
Adgra3 G A 5: 49,979,368 T661M probably damaging Het
Akap13 T A 7: 75,579,564 C161* probably null Het
Akr1c12 A C 13: 4,273,817 S162A possibly damaging Het
Anks1 C A 17: 28,051,578 H805N probably benign Het
Arhgap22 T C 14: 33,362,543 C260R probably damaging Het
Banf1 T C 19: 5,365,844 R33G probably benign Het
Bcas1 T C 2: 170,384,325 K310R probably damaging Het
Cacna1c G T 6: 118,652,058 H1240N probably damaging Het
Cartpt C T 13: 99,900,080 probably null Het
Ccdc127 T A 13: 74,357,045 Y237* probably null Het
Ccnb1ip1 A T 14: 50,792,277 Y109* probably null Het
Cenpj A T 14: 56,553,383 V403E possibly damaging Het
Cps1 A G 1: 67,196,560 Y951C probably damaging Het
Dcakd T C 11: 102,999,808 E51G possibly damaging Het
Dennd4a A T 9: 64,894,407 N944I probably benign Het
Dus3l C T 17: 56,768,566 R430C probably benign Het
Dync2h1 A G 9: 7,169,640 L279P possibly damaging Het
Dzip3 G A 16: 48,979,590 Q112* probably null Het
Eif1ad T A 19: 5,368,191 M1K probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam46c C A 3: 100,473,199 L80F probably benign Het
Fancg T C 4: 43,005,272 E366G probably benign Het
Gin1 C T 1: 97,784,840 P154S probably damaging Het
Gm11938 A T 11: 99,603,006 C88S possibly damaging Het
Gm38394 A G 1: 133,657,040 V853A probably benign Het
Gpr183 T C 14: 121,954,737 D124G probably damaging Het
Gucy2g T A 19: 55,238,068 I139F probably damaging Het
Iqub A T 6: 24,479,184 M453K probably benign Het
Jcad A G 18: 4,674,175 T646A probably benign Het
Kif23 A T 9: 61,945,359 D24E probably benign Het
Kmt2c T C 5: 25,366,177 N845S probably damaging Het
Lhx5 G A 5: 120,439,967 S284N probably benign Het
Lrrc7 C T 3: 158,202,495 probably null Het
Magi1 A G 6: 93,680,787 probably null Het
Mast2 A G 4: 116,308,650 S1287P probably damaging Het
Mepce C T 5: 137,786,643 probably benign Het
Mkrn1 A G 6: 39,405,757 V173A probably damaging Het
Myo1c C T 11: 75,670,030 R770* probably null Het
Naip6 A G 13: 100,294,731 probably null Het
Nsmce3 A T 7: 64,872,782 L46Q probably benign Het
Olfr1294 A T 2: 111,537,935 M118K probably damaging Het
Olfr354 G A 2: 36,907,393 C149Y probably benign Het
Olfr531 T G 7: 140,400,305 Y247S probably damaging Het
Olfr681 T C 7: 105,122,306 L283P probably damaging Het
Olfr78 A G 7: 102,742,601 V134A probably damaging Het
Parp14 A G 16: 35,858,321 F426L probably benign Het
Pcf11 A T 7: 92,657,529 S1144T possibly damaging Het
Prpf3 T A 3: 95,851,664 T59S possibly damaging Het
Ptgir A G 7: 16,906,869 M29V possibly damaging Het
Ptk7 A G 17: 46,574,466 V678A probably benign Het
Rb1 A G 14: 73,273,676 L331S probably damaging Het
Sell A G 1: 164,065,473 Y86C probably damaging Het
Serpina1e G A 12: 103,948,082 R328W probably damaging Het
Sertad3 T G 7: 27,476,666 L175R possibly damaging Het
Stard9 G T 2: 120,698,640 G1793W probably damaging Het
Stra6 T C 9: 58,149,234 I383T probably benign Het
Tcf7l1 A G 6: 72,649,178 L154P probably damaging Het
Tonsl A T 15: 76,623,410 D55E probably benign Het
Ttc21b A G 2: 66,226,913 S572P possibly damaging Het
Ttc7 T A 17: 87,346,620 L575Q probably damaging Het
Ubl4b C T 3: 107,554,878 S22N probably damaging Het
Ubr4 T C 4: 139,436,191 V2634A possibly damaging Het
Zfp46 A C 4: 136,290,173 D106A probably damaging Het
Zfp951 A C 5: 104,814,701 I333S probably benign Het
Other mutations in Lipf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Lipf APN 19 33970779 missense probably benign 0.33
IGL02024:Lipf APN 19 33976595 missense probably damaging 1.00
R1427:Lipf UTSW 19 33965600 missense probably damaging 1.00
R1454:Lipf UTSW 19 33970732 splice site probably benign
R1484:Lipf UTSW 19 33964780 missense probably benign 0.00
R1636:Lipf UTSW 19 33976535 missense probably damaging 1.00
R1720:Lipf UTSW 19 33965666 nonsense probably null
R1916:Lipf UTSW 19 33965675 missense probably benign 0.07
R2010:Lipf UTSW 19 33973546 missense probably benign
R2519:Lipf UTSW 19 33965525 missense probably damaging 0.99
R2937:Lipf UTSW 19 33973038 missense probably damaging 1.00
R4063:Lipf UTSW 19 33965565 missense probably benign 0.43
R4640:Lipf UTSW 19 33968797 missense probably damaging 0.98
R4818:Lipf UTSW 19 33965688 missense probably benign 0.04
R5619:Lipf UTSW 19 33966892 missense possibly damaging 0.95
R6034:Lipf UTSW 19 33964889 missense probably benign
R6034:Lipf UTSW 19 33964889 missense probably benign
R6045:Lipf UTSW 19 33966844 missense probably damaging 1.00
R6464:Lipf UTSW 19 33973544 missense probably benign 0.00
R7502:Lipf UTSW 19 33976606 missense probably damaging 1.00
R7649:Lipf UTSW 19 33965698 missense possibly damaging 0.84
R7713:Lipf UTSW 19 33973065 missense probably damaging 1.00
R7714:Lipf UTSW 19 33965648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATTGCAGTGTGGAACGGTG -3'
(R):5'- TGCCTCAGAAATGTATTCTCTCAG -3'

Sequencing Primer
(F):5'- AACGGTGGCCATGACATC -3'
(R):5'- TCAGAAATGTATTCTCTCAGTGTTTC -3'
Posted On2015-10-08