Incidental Mutation 'R4672:Megf6'
ID348513
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
MMRRC Submission 041927-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4672 (G1)
Quality Score210
Status Validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 154249452 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 212 (N212K)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably damaging
Transcript: ENSMUST00000030897
AA Change: N212K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: N212K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152159
AA Change: N104K

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: N104K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183595
Meta Mutation Damage Score 0.6448 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Abca8b A G 11: 109,936,448 F1507L possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Mast3 CATA CA 8: 70,784,797 probably null Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Osbpl9 A G 4: 109,064,609 I604T possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rasal2 A G 1: 157,243,661 F41S probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Sox5 T C 6: 143,833,349 Y687C probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 intron probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCTCTAAGTGGGCTGGGTTTAC -3'
(R):5'- AGGTATCCATCCTCACATCAGC -3'

Sequencing Primer
(F):5'- AGAGAGATCTATTGTACTGTGGACCC -3'
(R):5'- AGCTTCTCCCCTGAATCCTGG -3'
Posted On2015-10-08