Incidental Mutation 'R0265:Atp11a'
ID34853
Institutional Source Beutler Lab
Gene Symbol Atp11a
Ensembl Gene ENSMUSG00000031441
Gene NameATPase, class VI, type 11A
SynonymsIh, 4930558F19Rik
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0265 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12757014-12868728 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 12856930 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000033818] [ENSMUST00000091237] [ENSMUST00000132974] [ENSMUST00000133338]
Predicted Effect probably benign
Transcript: ENSMUST00000033818
SMART Domains Protein: ENSMUSP00000033818
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 3.6e-26 PFAM
Pfam:E1-E2_ATPase 101 377 1.1e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 9.9e-21 PFAM
Pfam:Cation_ATPase 476 589 2.5e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 2e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091237
SMART Domains Protein: ENSMUSP00000088779
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 25 96 7.3e-26 PFAM
Pfam:E1-E2_ATPase 101 377 2.7e-12 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:HAD 411 837 1.9e-20 PFAM
Pfam:Cation_ATPase 476 589 7.4e-11 PFAM
Pfam:PhoLip_ATPase_C 854 1106 4.5e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131804
SMART Domains Protein: ENSMUSP00000121567
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
SCOP:d1eula_ 6 53 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132974
SMART Domains Protein: ENSMUSP00000117091
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:Hydrolase_like2 1 42 2.6e-8 PFAM
Pfam:HAD 17 290 4.1e-14 PFAM
Pfam:Hydrolase 20 293 7.7e-13 PFAM
transmembrane domain 420 442 N/A INTRINSIC
transmembrane domain 454 476 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
transmembrane domain 520 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133338
SMART Domains Protein: ENSMUSP00000120625
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:E1-E2_ATPase 99 291 7.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139545
Predicted Effect probably benign
Transcript: ENSMUST00000143359
SMART Domains Protein: ENSMUSP00000114312
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 98 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145372
Predicted Effect probably benign
Transcript: ENSMUST00000152273
SMART Domains Protein: ENSMUSP00000121989
Gene: ENSMUSG00000031441

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_C 1 157 1.7e-43 PFAM
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral membrane ATPase. The encoded protein is probably phosphorylated in its intermediate state and likely drives the transport of ions such as calcium across membranes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Atp11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Atp11a APN 8 12844609 missense probably damaging 1.00
IGL01397:Atp11a APN 8 12812321 missense probably damaging 1.00
IGL01712:Atp11a APN 8 12851138 missense probably benign 0.11
IGL02113:Atp11a APN 8 12865048 missense probably benign
IGL02449:Atp11a APN 8 12757358 splice site probably null
IGL02550:Atp11a APN 8 12816997 missense possibly damaging 0.72
IGL03099:Atp11a APN 8 12827462 missense possibly damaging 0.52
R0139:Atp11a UTSW 8 12846054 missense probably benign 0.00
R0294:Atp11a UTSW 8 12827524 missense probably benign 0.03
R0331:Atp11a UTSW 8 12816953 nonsense probably null
R0582:Atp11a UTSW 8 12831214 missense probably benign 0.10
R1033:Atp11a UTSW 8 12828555 missense probably damaging 1.00
R1213:Atp11a UTSW 8 12842859 missense probably benign 0.04
R1551:Atp11a UTSW 8 12812340 missense probably damaging 1.00
R1648:Atp11a UTSW 8 12847495 missense probably damaging 1.00
R1752:Atp11a UTSW 8 12813094 missense probably damaging 1.00
R1826:Atp11a UTSW 8 12846154 missense probably damaging 1.00
R1887:Atp11a UTSW 8 12812324 missense probably damaging 1.00
R2079:Atp11a UTSW 8 12857902 missense probably damaging 1.00
R2106:Atp11a UTSW 8 12835228 missense probably benign
R2319:Atp11a UTSW 8 12847505 missense probably damaging 1.00
R2966:Atp11a UTSW 8 12847853 splice site probably null
R4021:Atp11a UTSW 8 12842938 missense probably benign 0.01
R4183:Atp11a UTSW 8 12816990 missense possibly damaging 0.94
R4640:Atp11a UTSW 8 12828434 splice site probably benign
R4705:Atp11a UTSW 8 12813118 missense probably damaging 1.00
R5354:Atp11a UTSW 8 12806753 missense probably damaging 1.00
R5777:Atp11a UTSW 8 12832522 missense probably damaging 0.99
R6152:Atp11a UTSW 8 12846100 missense probably damaging 0.97
R6171:Atp11a UTSW 8 12832663 missense probably damaging 1.00
R6197:Atp11a UTSW 8 12846099 missense probably benign 0.01
R6335:Atp11a UTSW 8 12859481 critical splice donor site probably null
R6526:Atp11a UTSW 8 12864999 missense probably benign
R6792:Atp11a UTSW 8 12861939 unclassified probably benign
R6923:Atp11a UTSW 8 12856949 missense probably damaging 0.99
R6959:Atp11a UTSW 8 12820467 missense probably damaging 1.00
R7297:Atp11a UTSW 8 12806774 critical splice donor site probably null
R7499:Atp11a UTSW 8 12832575 missense probably benign 0.01
R7606:Atp11a UTSW 8 12844427 missense probably damaging 1.00
R7844:Atp11a UTSW 8 12851039 missense possibly damaging 0.68
R8099:Atp11a UTSW 8 12861973 missense
R8479:Atp11a UTSW 8 12842932 missense possibly damaging 0.94
R8546:Atp11a UTSW 8 12851083 missense probably damaging 1.00
R8803:Atp11a UTSW 8 12825721 missense probably benign 0.18
R8896:Atp11a UTSW 8 12849781 missense probably damaging 1.00
X0017:Atp11a UTSW 8 12826323 critical splice acceptor site probably null
X0022:Atp11a UTSW 8 12847794 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCAGACCAGCAGGACACTACTAC -3'
(R):5'- ACTCGCTGGGACCTGGATATGAAC -3'

Sequencing Primer
(F):5'- TACTACATCCTTGACCCAGGC -3'
(R):5'- CTGGGACCTGGATATGAACTGAAG -3'
Posted On2013-05-09