Mutagenetix > Incidental Mutation

Incidental Mutation 'R4672:Mast3'

348536

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

041927-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4672 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

CATA to CA at 70784797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably null
Transcript: ENSMUST00000166004
AA Change: 592

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: 592

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably null
Transcript: ENSMUST00000211948

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (113/115)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	A	G	3: 36,889,990	*330W	probably null	Het
Abca8a	G	A	11: 110,071,876	L483F	possibly damaging	Het
Abca8b	A	G	11: 109,936,448	F1507L	possibly damaging	Het
Adamdec1	C	A	14: 68,577,904	E104*	probably null	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
AI464131	T	A	4: 41,499,061	M190L	probably benign	Het
Alppl2	T	C	1: 87,089,465		probably benign	Het
Aplnr	A	G	2: 85,137,180	Y183C	probably damaging	Het
Atm	G	A	9: 53,522,201	R250W	probably damaging	Het
B4galt7	T	C	13: 55,609,319	L275P	probably damaging	Het
C87414	T	A	5: 93,636,323	R230S	probably damaging	Het
Ccdc178	G	A	18: 22,150,444	Q10*	probably null	Het
Ccr9	T	C	9: 123,779,687	Y145H	probably damaging	Het
Cd209f	C	T	8: 4,103,685	G188D	probably damaging	Het
Cep70	T	A	9: 99,254,312	S23T	possibly damaging	Het
Cpped1	C	A	16: 11,805,374	E294*	probably null	Het
Crisp1	T	A	17: 40,294,513		probably null	Het
Disp1	T	C	1: 183,098,651		probably null	Het
Dlg2	A	T	7: 92,286,535	M624L	probably damaging	Het
Elf2	A	G	3: 51,256,434	V558A	probably damaging	Het
Eno2	T	C	6: 124,766,146	D209G	probably damaging	Het
Fam187b	G	A	7: 30,977,543	R159H	probably damaging	Het
Fh1	G	A	1: 175,604,051	A423V	probably benign	Het
Frg1	C	T	8: 41,400,809	D164N	probably benign	Het
Fsbp	T	G	4: 11,579,841	N36K	probably benign	Het
Gcn1l1	A	G	5: 115,606,520	T1592A	probably damaging	Het
Gimap3	A	G	6: 48,765,753	I81T	probably damaging	Het
Gjb6	C	T	14: 57,124,778	V9I	probably benign	Het
Gkap1	T	C	13: 58,263,956	S68G	possibly damaging	Het
Gm8765	T	C	13: 50,703,172	Y949H	probably benign	Het
Gpatch8	A	T	11: 102,478,958	S1251R	probably damaging	Het
Gria4	A	G	9: 4,664,981	F92L	possibly damaging	Het
H2-Q1	C	A	17: 35,320,930	D58E	probably damaging	Het
Hs1bp3	G	T	12: 8,341,983	G362*	probably null	Het
Igfn1	T	A	1: 135,965,369	H2114L	possibly damaging	Het
Igkv12-98	A	G	6: 68,570,956	Q22R	probably benign	Het
Ing3	A	G	6: 21,965,730		probably null	Het
Insr	C	T	8: 3,167,501		probably null	Het
Kdm3b	T	C	18: 34,808,577	S374P	probably benign	Het
Kif14	A	C	1: 136,521,278	Q1472P	probably benign	Het
Kif14	G	T	1: 136,521,279	Q1472H	probably benign	Het
Knstrn	A	G	2: 118,834,031	E202G	probably damaging	Het
Knstrn	G	T	2: 118,834,032	E202D	possibly damaging	Het
Krt12	A	G	11: 99,418,683		probably benign	Het
Lgi3	A	T	14: 70,534,457	I195F	possibly damaging	Het
Lima1	T	C	15: 99,843,709	N29D	probably damaging	Het
Liph	T	C	16: 21,984,056	I88V	probably benign	Het
Lrrk1	A	G	7: 66,279,372	S86P	probably benign	Het
Lsamp	A	G	16: 41,955,334	R166G	probably damaging	Het
Mamdc2	T	A	19: 23,350,784	N407Y	probably damaging	Het
Megf6	T	A	4: 154,249,452	N212K	probably damaging	Het
Met	A	C	6: 17,571,804	D1374A	probably benign	Het
Mrc2	A	G	11: 105,343,097	T902A	probably benign	Het
Mroh3	T	A	1: 136,190,975	T535S	probably benign	Het
Muc1	G	T	3: 89,232,077	V595L	probably damaging	Het
Myh2	T	A	11: 67,188,477	L957Q	probably damaging	Het
Ncl	A	T	1: 86,356,602	D257E	probably benign	Het
Nipbl	T	A	15: 8,302,984	D2263V	probably damaging	Het
Olfr1290	A	T	2: 111,489,557	N200K	possibly damaging	Het
Olfr727	A	G	14: 50,127,257	N227D	probably benign	Het
Olfr855	A	G	9: 19,585,430	K298E	possibly damaging	Het
Optc	C	A	1: 133,897,817	V324L	possibly damaging	Het
Osbpl9	A	G	4: 109,064,609	I604T	possibly damaging	Het
Otog	C	A	7: 46,289,786	A2080D	probably damaging	Het
Parp6	G	C	9: 59,640,110	R460P	probably damaging	Het
Phactr4	G	T	4: 132,370,706	P417Q	probably damaging	Het
Pigt	T	C	2: 164,497,578		probably benign	Het
Plekha5	A	G	6: 140,524,929	I99V	probably damaging	Het
Plxna3	T	G	X: 74,338,948		probably null	Het
Ppp2r1b	G	A	9: 50,867,719	M362I	probably damaging	Het
Rad51	A	G	2: 119,123,846	I136V	probably benign	Het
Rad54b	T	A	4: 11,609,449	H633Q	probably benign	Het
Rasal2	A	G	1: 157,243,661	F41S	probably benign	Het
Reep3	T	A	10: 67,021,850	H154L	probably benign	Het
Rp1l1	T	G	14: 64,031,270	V1435G	probably damaging	Het
Rps6ka5	C	A	12: 100,654,287	K125N	possibly damaging	Het
Rsad1	A	T	11: 94,543,618	M330K	probably damaging	Het
Scand1	A	G	2: 156,311,930		probably null	Het
Setd6	A	G	8: 95,718,012	H111R	probably null	Het
Slc27a3	T	C	3: 90,387,646	N368S	possibly damaging	Het
Slc38a2	T	C	15: 96,698,637	T32A	probably benign	Het
Smg7	A	G	1: 152,845,413	S683P	probably damaging	Het
Smyd2	A	T	1: 189,909,904	L62M	probably damaging	Het
Sox5	T	C	6: 143,833,349	Y687C	probably damaging	Het
Spaca6	T	A	17: 17,836,743	C53*	probably null	Het
Spire2	T	C	8: 123,358,111	V230A	probably benign	Het
Sptbn2	G	T	19: 4,732,496	V487L	probably benign	Het
Stk3	T	A	15: 35,099,457	I110L	probably benign	Het
Stox2	T	A	8: 47,192,106	Y773F	probably damaging	Het
Tbrg1	C	A	9: 37,651,336	A259S	probably damaging	Het
Tnfsf18	C	A	1: 161,503,738	D152E	probably benign	Het
Tpr	G	A	1: 150,423,567	A1173T	probably benign	Het
Trrap	T	C	5: 144,785,480	L271P	probably damaging	Het
Ttn	G	T	2: 76,827,075		probably benign	Het
U2surp	A	G	9: 95,493,145	S192P	possibly damaging	Het
Ubr4	C	T	4: 139,410,716	S1128L	probably damaging	Het
Ucma	G	A	2: 4,976,654		probably null	Het
Urb1	A	T	16: 90,772,634	D1401E	probably benign	Het
Usp54	A	T	14: 20,581,529		probably benign	Het
Vmn1r31	A	G	6: 58,472,071	Y270H	probably damaging	Het
Vmn1r90	T	A	7: 14,561,568	T202S	probably benign	Het
Vmn2r88	A	G	14: 51,418,155	Y616C	probably damaging	Het
Vmn2r95	T	A	17: 18,452,151	W717R	probably damaging	Het
Zcchc4	C	A	5: 52,796,605	T209K	probably benign	Het
Zfp955b	T	A	17: 33,305,259		probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATCAGGTCCTGAGCGTCAAG -3'
(R):5'- TGTGTAGGCTAGCCTCATTTC -3'

Sequencing Primer
(F):5'- ACATGATCTCATCTGAAGTTCCGGG -3'
(R):5'- AGCCTCATTTCCCATGTGTGTAGG -3'

Posted On

2015-10-08