Incidental Mutation 'R4672:Mast3'
ID348536
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 041927-MU
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4672 (G1)
Quality Score217
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CATA to CA at 70784797 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
Predicted Effect probably null
Transcript: ENSMUST00000166004
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably null
Transcript: ENSMUST00000211948
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (113/115)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 36,889,990 *330W probably null Het
Abca8a G A 11: 110,071,876 L483F possibly damaging Het
Abca8b A G 11: 109,936,448 F1507L possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Adamts16 G A 13: 70,779,518 probably benign Het
AI464131 T A 4: 41,499,061 M190L probably benign Het
Alppl2 T C 1: 87,089,465 probably benign Het
Aplnr A G 2: 85,137,180 Y183C probably damaging Het
Atm G A 9: 53,522,201 R250W probably damaging Het
B4galt7 T C 13: 55,609,319 L275P probably damaging Het
C87414 T A 5: 93,636,323 R230S probably damaging Het
Ccdc178 G A 18: 22,150,444 Q10* probably null Het
Ccr9 T C 9: 123,779,687 Y145H probably damaging Het
Cd209f C T 8: 4,103,685 G188D probably damaging Het
Cep70 T A 9: 99,254,312 S23T possibly damaging Het
Cpped1 C A 16: 11,805,374 E294* probably null Het
Crisp1 T A 17: 40,294,513 probably null Het
Disp1 T C 1: 183,098,651 probably null Het
Dlg2 A T 7: 92,286,535 M624L probably damaging Het
Elf2 A G 3: 51,256,434 V558A probably damaging Het
Eno2 T C 6: 124,766,146 D209G probably damaging Het
Fam187b G A 7: 30,977,543 R159H probably damaging Het
Fh1 G A 1: 175,604,051 A423V probably benign Het
Frg1 C T 8: 41,400,809 D164N probably benign Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gcn1l1 A G 5: 115,606,520 T1592A probably damaging Het
Gimap3 A G 6: 48,765,753 I81T probably damaging Het
Gjb6 C T 14: 57,124,778 V9I probably benign Het
Gkap1 T C 13: 58,263,956 S68G possibly damaging Het
Gm8765 T C 13: 50,703,172 Y949H probably benign Het
Gpatch8 A T 11: 102,478,958 S1251R probably damaging Het
Gria4 A G 9: 4,664,981 F92L possibly damaging Het
H2-Q1 C A 17: 35,320,930 D58E probably damaging Het
Hs1bp3 G T 12: 8,341,983 G362* probably null Het
Igfn1 T A 1: 135,965,369 H2114L possibly damaging Het
Igkv12-98 A G 6: 68,570,956 Q22R probably benign Het
Ing3 A G 6: 21,965,730 probably null Het
Insr C T 8: 3,167,501 probably null Het
Kdm3b T C 18: 34,808,577 S374P probably benign Het
Kif14 A C 1: 136,521,278 Q1472P probably benign Het
Kif14 G T 1: 136,521,279 Q1472H probably benign Het
Knstrn A G 2: 118,834,031 E202G probably damaging Het
Knstrn G T 2: 118,834,032 E202D possibly damaging Het
Krt12 A G 11: 99,418,683 probably benign Het
Lgi3 A T 14: 70,534,457 I195F possibly damaging Het
Lima1 T C 15: 99,843,709 N29D probably damaging Het
Liph T C 16: 21,984,056 I88V probably benign Het
Lrrk1 A G 7: 66,279,372 S86P probably benign Het
Lsamp A G 16: 41,955,334 R166G probably damaging Het
Mamdc2 T A 19: 23,350,784 N407Y probably damaging Het
Megf6 T A 4: 154,249,452 N212K probably damaging Het
Met A C 6: 17,571,804 D1374A probably benign Het
Mrc2 A G 11: 105,343,097 T902A probably benign Het
Mroh3 T A 1: 136,190,975 T535S probably benign Het
Muc1 G T 3: 89,232,077 V595L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Ncl A T 1: 86,356,602 D257E probably benign Het
Nipbl T A 15: 8,302,984 D2263V probably damaging Het
Olfr1290 A T 2: 111,489,557 N200K possibly damaging Het
Olfr727 A G 14: 50,127,257 N227D probably benign Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Optc C A 1: 133,897,817 V324L possibly damaging Het
Osbpl9 A G 4: 109,064,609 I604T possibly damaging Het
Otog C A 7: 46,289,786 A2080D probably damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phactr4 G T 4: 132,370,706 P417Q probably damaging Het
Pigt T C 2: 164,497,578 probably benign Het
Plekha5 A G 6: 140,524,929 I99V probably damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Ppp2r1b G A 9: 50,867,719 M362I probably damaging Het
Rad51 A G 2: 119,123,846 I136V probably benign Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rasal2 A G 1: 157,243,661 F41S probably benign Het
Reep3 T A 10: 67,021,850 H154L probably benign Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Rps6ka5 C A 12: 100,654,287 K125N possibly damaging Het
Rsad1 A T 11: 94,543,618 M330K probably damaging Het
Scand1 A G 2: 156,311,930 probably null Het
Setd6 A G 8: 95,718,012 H111R probably null Het
Slc27a3 T C 3: 90,387,646 N368S possibly damaging Het
Slc38a2 T C 15: 96,698,637 T32A probably benign Het
Smg7 A G 1: 152,845,413 S683P probably damaging Het
Smyd2 A T 1: 189,909,904 L62M probably damaging Het
Sox5 T C 6: 143,833,349 Y687C probably damaging Het
Spaca6 T A 17: 17,836,743 C53* probably null Het
Spire2 T C 8: 123,358,111 V230A probably benign Het
Sptbn2 G T 19: 4,732,496 V487L probably benign Het
Stk3 T A 15: 35,099,457 I110L probably benign Het
Stox2 T A 8: 47,192,106 Y773F probably damaging Het
Tbrg1 C A 9: 37,651,336 A259S probably damaging Het
Tnfsf18 C A 1: 161,503,738 D152E probably benign Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Trrap T C 5: 144,785,480 L271P probably damaging Het
Ttn G T 2: 76,827,075 probably benign Het
U2surp A G 9: 95,493,145 S192P possibly damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucma G A 2: 4,976,654 probably null Het
Urb1 A T 16: 90,772,634 D1401E probably benign Het
Usp54 A T 14: 20,581,529 probably benign Het
Vmn1r31 A G 6: 58,472,071 Y270H probably damaging Het
Vmn1r90 T A 7: 14,561,568 T202S probably benign Het
Vmn2r88 A G 14: 51,418,155 Y616C probably damaging Het
Vmn2r95 T A 17: 18,452,151 W717R probably damaging Het
Zcchc4 C A 5: 52,796,605 T209K probably benign Het
Zfp955b T A 17: 33,305,259 probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1208:Mast3 UTSW 8 70788272 unclassified probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGGTCCTGAGCGTCAAG -3'
(R):5'- TGTGTAGGCTAGCCTCATTTC -3'

Sequencing Primer
(F):5'- ACATGATCTCATCTGAAGTTCCGGG -3'
(R):5'- AGCCTCATTTCCCATGTGTGTAGG -3'
Posted On2015-10-08