Incidental Mutation 'R0265:Sorbs2'
ID34855
Institutional Source Beutler Lab
Gene Symbol Sorbs2
Ensembl Gene ENSMUSG00000031626
Gene Namesorbin and SH3 domain containing 2
Synonyms
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0265 (G1)
Quality Score201
Status Validated
Chromosome8
Chromosomal Location45507788-45827906 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 45785337 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067065] [ENSMUST00000067107] [ENSMUST00000125295] [ENSMUST00000130011] [ENSMUST00000132139] [ENSMUST00000135336] [ENSMUST00000138049] [ENSMUST00000139869] [ENSMUST00000153798] [ENSMUST00000171337] [ENSMUST00000211095]
Predicted Effect probably benign
Transcript: ENSMUST00000067065
SMART Domains Protein: ENSMUSP00000070720
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 105 121 N/A INTRINSIC
low complexity region 136 154 N/A INTRINSIC
low complexity region 266 283 N/A INTRINSIC
low complexity region 362 373 N/A INTRINSIC
low complexity region 606 618 N/A INTRINSIC
low complexity region 619 630 N/A INTRINSIC
SH3 845 900 5.1e-23 SMART
low complexity region 901 916 N/A INTRINSIC
SH3 920 977 3.9e-19 SMART
SH3 1023 1079 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000067107
SMART Domains Protein: ENSMUSP00000067641
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125295
SMART Domains Protein: ENSMUSP00000116768
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 6 56 9.63e-34 SMART
low complexity region 103 116 N/A INTRINSIC
low complexity region 160 176 N/A INTRINSIC
low complexity region 191 209 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
SH3 900 955 5.1e-23 SMART
low complexity region 956 971 N/A INTRINSIC
SH3 975 1032 3.9e-19 SMART
SH3 1078 1134 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130011
SMART Domains Protein: ENSMUSP00000121619
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 113 163 1.01e-27 SMART
low complexity region 195 208 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 283 301 N/A INTRINSIC
low complexity region 366 383 N/A INTRINSIC
SH3 418 473 5.1e-23 SMART
low complexity region 474 489 N/A INTRINSIC
SH3 493 550 3.9e-19 SMART
SH3 596 652 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132139
SMART Domains Protein: ENSMUSP00000123250
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 144 194 9.63e-34 SMART
low complexity region 241 254 N/A INTRINSIC
low complexity region 298 314 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
low complexity region 431 448 N/A INTRINSIC
SH3 483 538 5.1e-23 SMART
low complexity region 539 554 N/A INTRINSIC
SH3 558 615 3.9e-19 SMART
SH3 636 707 2.16e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135116
Predicted Effect probably benign
Transcript: ENSMUST00000135336
SMART Domains Protein: ENSMUSP00000114286
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 382 399 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 735 746 N/A INTRINSIC
SH3 962 1017 5.1e-23 SMART
low complexity region 1018 1033 N/A INTRINSIC
SH3 1037 1094 3.9e-19 SMART
SH3 1140 1196 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138049
SMART Domains Protein: ENSMUSP00000123503
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 1.01e-27 SMART
low complexity region 249 262 N/A INTRINSIC
low complexity region 367 384 N/A INTRINSIC
low complexity region 463 474 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139869
SMART Domains Protein: ENSMUSP00000121235
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 1.01e-27 SMART
low complexity region 218 231 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
SH3 389 444 5.1e-23 SMART
low complexity region 445 460 N/A INTRINSIC
SH3 464 521 3.9e-19 SMART
SH3 567 623 2.48e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140088
SMART Domains Protein: ENSMUSP00000114158
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 2 25 9.17e-1 SMART
low complexity region 57 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146627
SMART Domains Protein: ENSMUSP00000120487
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
low complexity region 41 59 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153798
SMART Domains Protein: ENSMUSP00000118353
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 136 186 9.63e-34 SMART
low complexity region 233 246 N/A INTRINSIC
low complexity region 351 368 N/A INTRINSIC
SH3 403 458 5.1e-23 SMART
low complexity region 459 474 N/A INTRINSIC
SH3 478 535 3.9e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155858
SMART Domains Protein: ENSMUSP00000122820
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
low complexity region 50 63 N/A INTRINSIC
low complexity region 107 123 N/A INTRINSIC
low complexity region 138 156 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171337
SMART Domains Protein: ENSMUSP00000128000
Gene: ENSMUSG00000031626

DomainStartEndE-ValueType
Sorb 167 217 9.63e-34 SMART
low complexity region 264 277 N/A INTRINSIC
low complexity region 401 418 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 754 765 N/A INTRINSIC
SH3 980 1035 5.1e-23 SMART
low complexity region 1036 1051 N/A INTRINSIC
SH3 1055 1112 3.9e-19 SMART
SH3 1158 1214 2.48e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209931
Predicted Effect probably benign
Transcript: ENSMUST00000211095
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211721
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arg and c-Abl represent the mammalian members of the Abelson family of non-receptor protein-tyrosine kinases. They interact with the Arg/Abl binding proteins via the SH3 domains present in the carboxy end of the latter group of proteins. This gene encodes the sorbin and SH3 domain containing 2 protein. It has three C-terminal SH3 domains and an N-terminal sorbin homology (SoHo) domain that interacts with lipid raft proteins. The subcellular localization of this protein in epithelial and cardiac muscle cells suggests that it functions as an adapter protein to assemble signaling complexes in stress fibers, and that it is a potential link between Abl family kinases and the actin cytoskeleton. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial postnatal lethality, reduced dendritic complexity, decreased excitatory synaptic transmission in dentate gyrus granule cells, a reduced acoustic startle response, and impaired long-term object recognition memory and contextual fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Osgin1 A G 8: 119,445,657 I397V possibly damaging Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Sorbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Sorbs2 APN 8 45799706 splice site probably null
IGL00964:Sorbs2 APN 8 45795677 missense probably damaging 0.97
IGL01101:Sorbs2 APN 8 45745423 missense possibly damaging 0.93
IGL01586:Sorbs2 APN 8 45795594 missense probably damaging 1.00
IGL01611:Sorbs2 APN 8 45795344 missense probably null
IGL01662:Sorbs2 APN 8 45803829 splice site probably benign
IGL01970:Sorbs2 APN 8 45745803 missense probably damaging 1.00
IGL02169:Sorbs2 APN 8 45823749 missense probably damaging 0.98
IGL02685:Sorbs2 APN 8 45803840 missense probably benign 0.00
IGL03036:Sorbs2 APN 8 45782865 missense probably benign
IGL03151:Sorbs2 APN 8 45799713 missense probably benign 0.01
IGL03164:Sorbs2 APN 8 45782874 missense probably benign 0.01
IGL03350:Sorbs2 APN 8 45805807 missense probably damaging 0.99
R0058:Sorbs2 UTSW 8 45785254 splice site probably null
R0058:Sorbs2 UTSW 8 45796263 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0233:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R0306:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R0308:Sorbs2 UTSW 8 45795130 nonsense probably null
R0638:Sorbs2 UTSW 8 45796310 missense probably damaging 1.00
R0940:Sorbs2 UTSW 8 45796502 missense probably benign 0.39
R1110:Sorbs2 UTSW 8 45795730 missense probably benign 0.13
R1160:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1226:Sorbs2 UTSW 8 45795619 missense probably damaging 1.00
R1271:Sorbs2 UTSW 8 45795967 missense probably damaging 1.00
R1440:Sorbs2 UTSW 8 45789963 splice site probably benign
R1514:Sorbs2 UTSW 8 45769829 missense probably damaging 1.00
R1557:Sorbs2 UTSW 8 45759197 splice site probably benign
R1582:Sorbs2 UTSW 8 45805777 missense probably damaging 0.99
R1626:Sorbs2 UTSW 8 45769854 missense probably damaging 1.00
R1700:Sorbs2 UTSW 8 45800984 missense probably damaging 1.00
R1759:Sorbs2 UTSW 8 45763019 makesense probably null
R1766:Sorbs2 UTSW 8 45770576 missense probably damaging 1.00
R1782:Sorbs2 UTSW 8 45805696 missense probably damaging 1.00
R1932:Sorbs2 UTSW 8 45796352 missense probably benign 0.01
R1954:Sorbs2 UTSW 8 45745738 missense probably benign 0.23
R2060:Sorbs2 UTSW 8 45775629 missense probably damaging 1.00
R2149:Sorbs2 UTSW 8 45795443 missense probably damaging 0.99
R2568:Sorbs2 UTSW 8 45795370 nonsense probably null
R3812:Sorbs2 UTSW 8 45763030 missense probably benign 0.00
R3831:Sorbs2 UTSW 8 45795095 missense probably damaging 1.00
R3975:Sorbs2 UTSW 8 45772710 critical splice donor site probably null
R4033:Sorbs2 UTSW 8 45775595 missense probably damaging 1.00
R4714:Sorbs2 UTSW 8 45795293 missense possibly damaging 0.89
R4828:Sorbs2 UTSW 8 45741615 intron probably benign
R4926:Sorbs2 UTSW 8 45796217 missense probably benign 0.03
R5027:Sorbs2 UTSW 8 45746534 intron probably null
R5118:Sorbs2 UTSW 8 45795785 missense probably damaging 1.00
R5159:Sorbs2 UTSW 8 45795730 missense probably benign 0.00
R5342:Sorbs2 UTSW 8 45796013 missense probably damaging 0.96
R5390:Sorbs2 UTSW 8 45819741 missense probably damaging 1.00
R5436:Sorbs2 UTSW 8 45796001 missense probably damaging 1.00
R5655:Sorbs2 UTSW 8 45741581 critical splice donor site probably null
R5687:Sorbs2 UTSW 8 45775632 missense probably damaging 1.00
R5695:Sorbs2 UTSW 8 45792875 missense probably benign 0.27
R5733:Sorbs2 UTSW 8 45759189 missense probably damaging 1.00
R5928:Sorbs2 UTSW 8 45763183 missense probably damaging 1.00
R5949:Sorbs2 UTSW 8 45769897 critical splice donor site probably null
R6341:Sorbs2 UTSW 8 45770578 missense probably damaging 1.00
R6620:Sorbs2 UTSW 8 45796176 missense probably damaging 1.00
R6761:Sorbs2 UTSW 8 45772614 missense probably damaging 1.00
R7349:Sorbs2 UTSW 8 45795823 nonsense probably null
R7404:Sorbs2 UTSW 8 45759196 splice site probably null
R7524:Sorbs2 UTSW 8 45795656 missense probably benign 0.00
R7809:Sorbs2 UTSW 8 45745428 missense possibly damaging 0.93
R7820:Sorbs2 UTSW 8 45796556 missense probably null 0.16
Z1176:Sorbs2 UTSW 8 45790025 missense probably null 0.96
Z1177:Sorbs2 UTSW 8 45782959 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCACTCTATGTGTACCCGATGCTG -3'
(R):5'- TGTGAGGGATGCTTTTCATCCACAG -3'

Sequencing Primer
(F):5'- GTCGGCACTCAGGTTCTAAC -3'
(R):5'- tgaatactttaacctaatgagccatc -3'
Posted On2013-05-09