Incidental Mutation 'R4673:Thap4'
ID348588
Institutional Source Beutler Lab
Gene Symbol Thap4
Ensembl Gene ENSMUSG00000026279
Gene NameTHAP domain containing 4
Synonyms2010320B01Rik
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4673 (G1)
Quality Score224
Status Not validated
Chromosome1
Chromosomal Location93701935-93754864 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 93714866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112905] [ENSMUST00000189728] [ENSMUST00000190116]
Predicted Effect probably benign
Transcript: ENSMUST00000112905
SMART Domains Protein: ENSMUSP00000108526
Gene: ENSMUSG00000026279

DomainStartEndE-ValueType
THAP 3 91 4.74e-21 SMART
DM3 24 90 2.99e-11 SMART
internal_repeat_1 197 254 9.38e-12 PROSPERO
low complexity region 280 294 N/A INTRINSIC
internal_repeat_1 301 358 9.38e-12 PROSPERO
low complexity region 377 388 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
Pfam:DUF1794 413 566 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187445
Predicted Effect unknown
Transcript: ENSMUST00000189472
AA Change: D171G
Predicted Effect probably benign
Transcript: ENSMUST00000189728
SMART Domains Protein: ENSMUSP00000143943
Gene: ENSMUSG00000026279

DomainStartEndE-ValueType
Pfam:DUF1794 9 162 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190116
SMART Domains Protein: ENSMUSP00000140761
Gene: ENSMUSG00000026279

DomainStartEndE-ValueType
THAP 3 91 4.74e-21 SMART
DM3 24 90 2.99e-11 SMART
internal_repeat_1 197 254 9.38e-12 PROSPERO
low complexity region 280 294 N/A INTRINSIC
internal_repeat_1 301 358 9.38e-12 PROSPERO
low complexity region 377 388 N/A INTRINSIC
low complexity region 390 404 N/A INTRINSIC
Pfam:DUF1794 412 567 1.3e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Thap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1839:Thap4 UTSW 1 93750287 missense probably benign 0.11
R2190:Thap4 UTSW 1 93750659 missense probably damaging 1.00
R2234:Thap4 UTSW 1 93725212 missense probably benign 0.14
R2235:Thap4 UTSW 1 93725212 missense probably benign 0.14
R4502:Thap4 UTSW 1 93750987 critical splice acceptor site probably null
R5011:Thap4 UTSW 1 93749876 missense probably damaging 0.99
R5647:Thap4 UTSW 1 93714943 missense probably damaging 0.99
R5690:Thap4 UTSW 1 93716630 critical splice donor site probably null
R6375:Thap4 UTSW 1 93725156 critical splice donor site probably null
R6899:Thap4 UTSW 1 93750969 missense probably damaging 1.00
R7431:Thap4 UTSW 1 93750501 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AAAGTGCACTTACCCTCTGG -3'
(R):5'- TGGGCATCACACTAACTGCC -3'

Sequencing Primer
(F):5'- CCTCTGGCTCAGTAACTTAGGAG -3'
(R):5'- GCATCACACTAACTGCCTCTCC -3'
Posted On2015-10-08