Incidental Mutation 'R0265:Osgin1'
ID34859
Institutional Source Beutler Lab
Gene Symbol Osgin1
Ensembl Gene ENSMUSG00000074063
Gene Nameoxidative stress induced growth inhibitor 1
Synonyms1700012B18Rik
MMRRC Submission 038491-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R0265 (G1)
Quality Score88
Status Validated
Chromosome8
Chromosomal Location119434124-119446256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119445657 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 397 (I397V)
Ref Sequence ENSEMBL: ENSMUSP00000114467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098363] [ENSMUST00000098365] [ENSMUST00000131448] [ENSMUST00000152420] [ENSMUST00000212112]
Predicted Effect probably benign
Transcript: ENSMUST00000098363
SMART Domains Protein: ENSMUSP00000095966
Gene: ENSMUSG00000031837

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
EFh 67 95 4.06e-2 SMART
EFh 101 129 3.21e0 SMART
low complexity region 185 196 N/A INTRINSIC
Pfam:ABM 289 363 2.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126414
Predicted Effect probably benign
Transcript: ENSMUST00000131448
SMART Domains Protein: ENSMUSP00000120477
Gene: ENSMUSG00000074063

DomainStartEndE-ValueType
SCOP:d1foha5 12 38 9e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145604
Predicted Effect possibly damaging
Transcript: ENSMUST00000152420
AA Change: I397V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114467
Gene: ENSMUSG00000074063
AA Change: I397V

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 205 465 3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212112
Meta Mutation Damage Score 0.4691 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an oxidative stress response protein that regulates cell death. Expression of the gene is regulated by p53 and is induced by DNA damage. The protein regulates apoptosis by inducing cytochrome c release from mitochondria. It also appears to be a key regulator of both inflammatory and anti-inflammatory molecules. The loss of this protein correlates with uncontrolled cell growth and tumor formation. Naturally occurring read-through transcription exists between this gene and the neighboring upstream malonyl-CoA decarboxylase (MLYCD) gene, but the read-through transcripts are unlikely to produce a protein product. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik T G 14: 8,431,667 Y655S probably damaging Het
9330182L06Rik T C 5: 9,434,681 L486P probably damaging Het
Abca14 A G 7: 120,223,627 I321V probably benign Het
Adcy7 A G 8: 88,324,763 D837G probably damaging Het
Aldh1a1 T A 19: 20,640,076 Y457* probably null Het
Alox5 T C 6: 116,420,362 Y287C probably benign Het
Ano8 T C 8: 71,480,524 probably benign Het
Ap3b1 A G 13: 94,493,681 K815E unknown Het
Atp11a A T 8: 12,856,930 probably benign Het
Atp6v0a1 A T 11: 101,048,515 D702V possibly damaging Het
Cacna1b T A 2: 24,761,844 N108Y probably damaging Het
Ccdc57 G C 11: 120,921,811 A39G probably benign Het
Cdhr1 A T 14: 37,081,376 V581D probably benign Het
Cyp2b23 A G 7: 26,672,879 probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Ddit4l C T 3: 137,624,287 probably benign Het
Dnah8 A T 17: 30,690,271 I1024F probably benign Het
Edc3 T A 9: 57,727,338 F213I probably damaging Het
Edrf1 G A 7: 133,657,045 D717N probably damaging Het
Efna5 G A 17: 62,651,073 P63S probably damaging Het
Entpd3 A G 9: 120,558,481 Y248C probably damaging Het
Flcn G A 11: 59,795,809 Q373* probably null Het
Fry T C 5: 150,434,776 V1908A probably damaging Het
Gabrg3 A T 7: 57,381,617 Y58* probably null Het
Gabrp A T 11: 33,552,614 Y417N probably damaging Het
Golga2 C A 2: 32,304,952 probably null Het
Grip2 C A 6: 91,773,792 probably null Het
Gsx2 A G 5: 75,077,068 Y227C probably damaging Het
Hif3a T C 7: 17,035,868 *665W probably null Het
Hist1h2aa T C 13: 23,934,649 V63A probably benign Het
Hsd3b1 C A 3: 98,852,773 V301L probably damaging Het
Ifitm5 T C 7: 140,950,008 probably benign Het
Inpp4a A T 1: 37,378,986 D498V probably damaging Het
Itga1 A T 13: 114,992,459 D554E probably benign Het
Itk G A 11: 46,389,458 probably benign Het
Kdm3b T A 18: 34,795,663 probably benign Het
Klhl6 A G 16: 19,948,234 V470A probably benign Het
Lamb3 T A 1: 193,320,531 W95R probably damaging Het
Lbhd2 T A 12: 111,410,242 I41N probably damaging Het
Lrp4 A T 2: 91,490,670 S1014C probably damaging Het
Ltbp2 C T 12: 84,785,969 probably null Het
Map3k19 A G 1: 127,822,182 I1144T possibly damaging Het
Mfsd10 T C 5: 34,635,163 probably benign Het
Mocos A G 18: 24,666,276 D189G probably benign Het
Mvb12a T A 8: 71,547,010 F224L probably damaging Het
Myo15 A T 11: 60,514,897 probably null Het
Nos2 A T 11: 78,937,602 H249L probably damaging Het
Notum A G 11: 120,658,334 M184T probably benign Het
Nvl C A 1: 181,134,830 D192Y probably damaging Het
Olfr1024 T A 2: 85,904,247 N269I probably benign Het
Olfr1065 C A 2: 86,445,959 V8L probably benign Het
Olfr1308 T C 2: 111,960,494 Y193C probably damaging Het
Olfr204 A T 16: 59,315,071 F112Y probably damaging Het
Olfr218 A G 1: 173,203,917 K187R probably benign Het
Otulin A G 15: 27,616,424 V123A probably damaging Het
P4ha1 A G 10: 59,348,259 Y181C probably damaging Het
Pcdhgc5 A T 18: 37,821,350 D559V probably damaging Het
Phf2 T C 13: 48,828,794 N151S unknown Het
Plxnc1 C A 10: 94,813,129 G1263C probably benign Het
Rad51ap1 A G 6: 126,924,197 *338Q probably null Het
Raver1 A G 9: 21,075,659 S676P probably benign Het
Rfx8 T C 1: 39,688,577 E196G possibly damaging Het
Rreb1 A T 13: 37,916,155 K187* probably null Het
Rxfp1 T C 3: 79,667,654 T217A probably benign Het
Rxra T C 2: 27,752,430 L305P probably damaging Het
Sardh T C 2: 27,227,066 probably benign Het
Skor2 A T 18: 76,876,598 E952D probably damaging Het
Slc22a29 A T 19: 8,169,970 S343T probably benign Het
Sorbs2 T C 8: 45,785,337 probably benign Het
Supt7l C T 5: 31,515,918 V329I probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Tac1 T C 6: 7,559,165 probably benign Het
Tcn2 A T 11: 3,922,044 V361D probably damaging Het
Tm2d3 G A 7: 65,697,834 A170T possibly damaging Het
Tnks G A 8: 34,839,970 R1142* probably null Het
Ttll7 C A 3: 146,944,160 Y648* probably null Het
Umod G T 7: 119,466,073 Q578K probably benign Het
Upf2 G A 2: 6,027,204 probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Washc5 A G 15: 59,338,960 I1013T probably benign Het
Wdr60 T C 12: 116,257,406 probably benign Het
Zfp704 C A 3: 9,565,157 R48L probably damaging Het
Other mutations in Osgin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Osgin1 APN 8 119445046 missense probably damaging 0.97
IGL02347:Osgin1 APN 8 119445538 missense probably benign 0.02
IGL02803:Osgin1 APN 8 119443267 missense probably benign 0.00
IGL03111:Osgin1 APN 8 119443049 missense probably damaging 0.96
R0137:Osgin1 UTSW 8 119442480 missense possibly damaging 0.73
R0520:Osgin1 UTSW 8 119442508 missense probably damaging 1.00
R0650:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0652:Osgin1 UTSW 8 119445472 missense probably damaging 1.00
R0687:Osgin1 UTSW 8 119445832 missense probably damaging 1.00
R1439:Osgin1 UTSW 8 119443113 splice site probably null
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1469:Osgin1 UTSW 8 119445385 missense possibly damaging 0.95
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R1470:Osgin1 UTSW 8 119444965 missense probably damaging 1.00
R2058:Osgin1 UTSW 8 119445673 missense possibly damaging 0.87
R2982:Osgin1 UTSW 8 119442535 missense probably damaging 1.00
R3880:Osgin1 UTSW 8 119441452 missense probably benign
R4076:Osgin1 UTSW 8 119445033 missense possibly damaging 0.64
R4594:Osgin1 UTSW 8 119445253 missense possibly damaging 0.49
R4914:Osgin1 UTSW 8 119442544 missense possibly damaging 0.91
R4991:Osgin1 UTSW 8 119445289 missense probably damaging 1.00
R5689:Osgin1 UTSW 8 119444989 makesense probably null
R6215:Osgin1 UTSW 8 119445444 missense probably benign 0.01
R7008:Osgin1 UTSW 8 119441494 missense possibly damaging 0.92
R7136:Osgin1 UTSW 8 119441437 start codon destroyed probably null 0.51
R7380:Osgin1 UTSW 8 119445431 missense probably benign 0.44
R7840:Osgin1 UTSW 8 119445034 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGAGTACCACAAAGTGCAGCAGATG -3'
(R):5'- GCCAGGCTAATGTTAAGGTGGCTTC -3'

Sequencing Primer
(F):5'- AGATGATGCGCGATCAGTCC -3'
(R):5'- TCCTTCTTCAGCAGGGAGC -3'
Posted On2013-05-09