Incidental Mutation 'R4673:Spta1'
ID348590
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 174191062 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably null
Transcript: ENSMUST00000027817
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7372:Spta1 UTSW 1 174197635 nonsense probably null
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAAAATGTCTTGCCAATG -3'
(R):5'- GGATGAATCTTGACTTGGTTTTCAC -3'

Sequencing Primer
(F):5'- TGTCTTGCCAATGAGGAAACCTG -3'
(R):5'- GTATATGGTCACAGAATCAAAGCAC -3'
Posted On2015-10-08