Incidental Mutation 'R0265:Raver1'
ID 34860
Institutional Source Beutler Lab
Gene Symbol Raver1
Ensembl Gene ENSMUSG00000010205
Gene Name ribonucleoprotein, PTB-binding 1
Synonyms 1300006N24Rik
MMRRC Submission 038491-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.327) question?
Stock # R0265 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 20985454-21003295 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20986955 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 676 (S676P)
Ref Sequence ENSEMBL: ENSMUSP00000151195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010348] [ENSMUST00000115487] [ENSMUST00000213826] [ENSMUST00000217359]
AlphaFold Q9CW46
Predicted Effect probably benign
Transcript: ENSMUST00000010348
SMART Domains Protein: ENSMUSP00000010348
Gene: ENSMUSG00000079677

DomainStartEndE-ValueType
Pfam:Fer2 64 147 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115487
AA Change: S676P

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111150
Gene: ENSMUSG00000010205
AA Change: S676P

DomainStartEndE-ValueType
low complexity region 15 26 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
RRM 60 126 1.53e-10 SMART
RRM 133 206 5.66e-14 SMART
RRM 222 295 1.15e-5 SMART
low complexity region 307 318 N/A INTRINSIC
low complexity region 324 339 N/A INTRINSIC
low complexity region 343 351 N/A INTRINSIC
low complexity region 360 396 N/A INTRINSIC
low complexity region 419 454 N/A INTRINSIC
low complexity region 460 474 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 547 565 N/A INTRINSIC
low complexity region 637 643 N/A INTRINSIC
low complexity region 675 699 N/A INTRINSIC
low complexity region 713 722 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183526
Predicted Effect probably benign
Transcript: ENSMUST00000213826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217150
Predicted Effect unknown
Transcript: ENSMUST00000217282
AA Change: S415P
Predicted Effect probably benign
Transcript: ENSMUST00000217359
AA Change: S676P

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.6%
  • 20x: 92.0%
Validation Efficiency 99% (83/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced long term potentiation and depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,822,850 (GRCm39) I321V probably benign Het
Adcy7 A G 8: 89,051,391 (GRCm39) D837G probably damaging Het
Aldh1a1 T A 19: 20,617,440 (GRCm39) Y457* probably null Het
Alox5 T C 6: 116,397,323 (GRCm39) Y287C probably benign Het
Ano8 T C 8: 71,933,168 (GRCm39) probably benign Het
Ap3b1 A G 13: 94,630,189 (GRCm39) K815E unknown Het
Atp11a A T 8: 12,906,930 (GRCm39) probably benign Het
Atp6v0a1 A T 11: 100,939,341 (GRCm39) D702V possibly damaging Het
Cacna1b T A 2: 24,651,856 (GRCm39) N108Y probably damaging Het
Ccdc57 G C 11: 120,812,637 (GRCm39) A39G probably benign Het
Cdhr1 A T 14: 36,803,333 (GRCm39) V581D probably benign Het
Cfap20dc T G 14: 8,431,667 (GRCm38) Y655S probably damaging Het
Cyp2b23 A G 7: 26,372,304 (GRCm39) probably benign Het
D430041D05Rik G C 2: 103,998,295 (GRCm39) P1836R probably damaging Het
Ddit4l C T 3: 137,330,048 (GRCm39) probably benign Het
Dnah8 A T 17: 30,909,245 (GRCm39) I1024F probably benign Het
Dync2i1 T C 12: 116,221,026 (GRCm39) probably benign Het
Edc3 T A 9: 57,634,621 (GRCm39) F213I probably damaging Het
Edrf1 G A 7: 133,258,774 (GRCm39) D717N probably damaging Het
Efna5 G A 17: 62,958,068 (GRCm39) P63S probably damaging Het
Elapor2 T C 5: 9,484,681 (GRCm39) L486P probably damaging Het
Entpd3 A G 9: 120,387,547 (GRCm39) Y248C probably damaging Het
Flcn G A 11: 59,686,635 (GRCm39) Q373* probably null Het
Fry T C 5: 150,358,241 (GRCm39) V1908A probably damaging Het
Gabrg3 A T 7: 57,031,365 (GRCm39) Y58* probably null Het
Gabrp A T 11: 33,502,614 (GRCm39) Y417N probably damaging Het
Golga2 C A 2: 32,194,964 (GRCm39) probably null Het
Grip2 C A 6: 91,750,773 (GRCm39) probably null Het
Gsx2 A G 5: 75,237,729 (GRCm39) Y227C probably damaging Het
H2ac1 T C 13: 24,118,632 (GRCm39) V63A probably benign Het
Hif3a T C 7: 16,769,793 (GRCm39) *665W probably null Het
Hsd3b1 C A 3: 98,760,089 (GRCm39) V301L probably damaging Het
Ifitm5 T C 7: 140,529,921 (GRCm39) probably benign Het
Inpp4a A T 1: 37,418,067 (GRCm39) D498V probably damaging Het
Itga1 A T 13: 115,128,995 (GRCm39) D554E probably benign Het
Itk G A 11: 46,280,285 (GRCm39) probably benign Het
Kdm3b T A 18: 34,928,716 (GRCm39) probably benign Het
Klhl6 A G 16: 19,766,984 (GRCm39) V470A probably benign Het
Lamb3 T A 1: 193,002,839 (GRCm39) W95R probably damaging Het
Lbhd2 T A 12: 111,376,676 (GRCm39) I41N probably damaging Het
Lrp4 A T 2: 91,321,015 (GRCm39) S1014C probably damaging Het
Ltbp2 C T 12: 84,832,743 (GRCm39) probably null Het
Map3k19 A G 1: 127,749,919 (GRCm39) I1144T possibly damaging Het
Mfsd10 T C 5: 34,792,507 (GRCm39) probably benign Het
Mocos A G 18: 24,799,333 (GRCm39) D189G probably benign Het
Mvb12a T A 8: 71,999,654 (GRCm39) F224L probably damaging Het
Myo15a A T 11: 60,405,723 (GRCm39) probably null Het
Nos2 A T 11: 78,828,428 (GRCm39) H249L probably damaging Het
Notum A G 11: 120,549,160 (GRCm39) M184T probably benign Het
Nvl C A 1: 180,962,395 (GRCm39) D192Y probably damaging Het
Or10j3 A G 1: 173,031,484 (GRCm39) K187R probably benign Het
Or4f57 T C 2: 111,790,839 (GRCm39) Y193C probably damaging Het
Or5ac22 A T 16: 59,135,434 (GRCm39) F112Y probably damaging Het
Or5m12 T A 2: 85,734,591 (GRCm39) N269I probably benign Het
Or8k27 C A 2: 86,276,303 (GRCm39) V8L probably benign Het
Osgin1 A G 8: 120,172,396 (GRCm39) I397V possibly damaging Het
Otulin A G 15: 27,616,510 (GRCm39) V123A probably damaging Het
P4ha1 A G 10: 59,184,081 (GRCm39) Y181C probably damaging Het
Pcdhgc5 A T 18: 37,954,403 (GRCm39) D559V probably damaging Het
Phf2 T C 13: 48,982,270 (GRCm39) N151S unknown Het
Plxnc1 C A 10: 94,648,991 (GRCm39) G1263C probably benign Het
Rad51ap1 A G 6: 126,901,160 (GRCm39) *338Q probably null Het
Rfx8 T C 1: 39,727,737 (GRCm39) E196G possibly damaging Het
Rreb1 A T 13: 38,100,131 (GRCm39) K187* probably null Het
Rxfp1 T C 3: 79,574,961 (GRCm39) T217A probably benign Het
Rxra T C 2: 27,642,442 (GRCm39) L305P probably damaging Het
Sardh T C 2: 27,117,078 (GRCm39) probably benign Het
Skor2 A T 18: 76,964,293 (GRCm39) E952D probably damaging Het
Slc22a29 A T 19: 8,147,334 (GRCm39) S343T probably benign Het
Sorbs2 T C 8: 46,238,374 (GRCm39) probably benign Het
Supt7l C T 5: 31,673,262 (GRCm39) V329I probably benign Het
Taar2 G A 10: 23,817,393 (GRCm39) R311H probably benign Het
Tac1 T C 6: 7,559,165 (GRCm39) probably benign Het
Tcn2 A T 11: 3,872,044 (GRCm39) V361D probably damaging Het
Tm2d3 G A 7: 65,347,582 (GRCm39) A170T possibly damaging Het
Tnks G A 8: 35,307,124 (GRCm39) R1142* probably null Het
Ttll7 C A 3: 146,649,915 (GRCm39) Y648* probably null Het
Umod G T 7: 119,065,296 (GRCm39) Q578K probably benign Het
Upf2 G A 2: 6,032,015 (GRCm39) probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Washc5 A G 15: 59,210,809 (GRCm39) I1013T probably benign Het
Zfp704 C A 3: 9,630,217 (GRCm39) R48L probably damaging Het
Other mutations in Raver1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01923:Raver1 APN 9 20,990,536 (GRCm39) missense probably damaging 1.00
IGL02863:Raver1 APN 9 20,987,267 (GRCm39) missense probably damaging 0.98
IGL03128:Raver1 APN 9 20,992,038 (GRCm39) missense probably damaging 1.00
R1017:Raver1 UTSW 9 20,990,886 (GRCm39) splice site probably benign
R3177:Raver1 UTSW 9 20,990,573 (GRCm39) missense possibly damaging 0.90
R3277:Raver1 UTSW 9 20,990,573 (GRCm39) missense possibly damaging 0.90
R4092:Raver1 UTSW 9 20,992,568 (GRCm39) missense probably damaging 0.99
R4463:Raver1 UTSW 9 21,003,123 (GRCm39) missense probably benign 0.01
R5302:Raver1 UTSW 9 20,986,677 (GRCm39) missense probably damaging 1.00
R5652:Raver1 UTSW 9 21,001,608 (GRCm39) missense probably damaging 0.98
R6021:Raver1 UTSW 9 20,987,918 (GRCm39) missense probably damaging 1.00
R7065:Raver1 UTSW 9 21,001,590 (GRCm39) missense probably benign 0.00
R7833:Raver1 UTSW 9 20,992,610 (GRCm39) missense probably benign 0.11
R8480:Raver1 UTSW 9 21,001,576 (GRCm39) missense probably benign 0.29
R9662:Raver1 UTSW 9 20,992,550 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GACCCCTTAGAAAATCCTCTTCCGC -3'
(R):5'- GAACAAGGTGAGTCTGCCCTACAAG -3'

Sequencing Primer
(F):5'- GGAAAAACTGCGTTTCTGGC -3'
(R):5'- TCTAGGACCATTGGAATGCC -3'
Posted On 2013-05-09