Incidental Mutation 'R4673:Adam39'
ID348622
Institutional Source Beutler Lab
Gene Symbol Adam39
Ensembl Gene ENSMUSG00000054033
Gene Namea disintegrin and metallopeptidase domain 39
Synonyms1700056P18Rik, testase 9
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40822990-40827037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40824731 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 53 (T53I)
Ref Sequence ENSEMBL: ENSMUSP00000065783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066814]
Predicted Effect probably benign
Transcript: ENSMUST00000066814
AA Change: T53I

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065783
Gene: ENSMUSG00000054033
AA Change: T53I

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 53 178 1.3e-19 PFAM
Pfam:Reprolysin_5 219 398 2.2e-18 PFAM
Pfam:Reprolysin_4 219 406 6.8e-16 PFAM
Pfam:Reprolysin 221 410 1.3e-43 PFAM
Pfam:Reprolysin_2 238 399 2.6e-12 PFAM
Pfam:Reprolysin_3 246 366 1.2e-17 PFAM
DISIN 428 503 3.97e-37 SMART
ACR 504 640 8.95e-74 SMART
transmembrane domain 702 724 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Adam39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Adam39 APN 8 40826746 missense possibly damaging 0.53
IGL01350:Adam39 APN 8 40825839 nonsense probably null
IGL02237:Adam39 APN 8 40825445 missense probably benign 0.39
IGL02688:Adam39 APN 8 40826320 missense probably benign 0.00
IGL02890:Adam39 APN 8 40825153 missense probably benign 0.03
IGL03071:Adam39 APN 8 40825067 missense probably benign 0.08
IGL03145:Adam39 APN 8 40824658 missense probably benign 0.00
R0083:Adam39 UTSW 8 40825078 missense probably damaging 0.98
R0086:Adam39 UTSW 8 40826360 missense possibly damaging 0.64
R0546:Adam39 UTSW 8 40826431 missense probably damaging 1.00
R0548:Adam39 UTSW 8 40826467 missense probably damaging 1.00
R1489:Adam39 UTSW 8 40824994 missense possibly damaging 0.49
R1643:Adam39 UTSW 8 40826486 missense possibly damaging 0.83
R1756:Adam39 UTSW 8 40825324 missense probably damaging 0.99
R2081:Adam39 UTSW 8 40826842 makesense probably null
R4510:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4511:Adam39 UTSW 8 40826291 missense probably damaging 1.00
R4612:Adam39 UTSW 8 40825921 missense probably damaging 0.96
R4704:Adam39 UTSW 8 40825796 missense probably benign
R4978:Adam39 UTSW 8 40825337 missense possibly damaging 0.49
R5116:Adam39 UTSW 8 40825001 missense probably damaging 1.00
R5269:Adam39 UTSW 8 40825981 missense probably benign 0.01
R5710:Adam39 UTSW 8 40824647 missense probably benign 0.05
R5971:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6067:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6078:Adam39 UTSW 8 40824593 missense probably benign 0.01
R6180:Adam39 UTSW 8 40826573 missense probably benign 0.03
R6358:Adam39 UTSW 8 40826681 missense probably benign 0.16
R6699:Adam39 UTSW 8 40826657 missense probably benign 0.01
R6896:Adam39 UTSW 8 40824938 missense possibly damaging 0.86
R7117:Adam39 UTSW 8 40826242 missense probably damaging 1.00
R7186:Adam39 UTSW 8 40826312 missense probably damaging 1.00
R7195:Adam39 UTSW 8 40824775 nonsense probably null
R7381:Adam39 UTSW 8 40825963 missense probably damaging 1.00
R7405:Adam39 UTSW 8 40824622 missense probably benign 0.01
R8068:Adam39 UTSW 8 40825938 missense not run
U15987:Adam39 UTSW 8 40824593 missense probably benign 0.01
Z1177:Adam39 UTSW 8 40825295 missense not run
Predicted Primers PCR Primer
(F):5'- TTAAAAGCCAGCACTGCATG -3'
(R):5'- GGCCATGGTAGTAGCAATCATTC -3'

Sequencing Primer
(F):5'- CTGCATGCAGACAACACAAAGGG -3'
(R):5'- ATCATTCTGGACATAAGGCTGGTCC -3'
Posted On2015-10-08