Incidental Mutation 'R4673:Tspan3'
ID348625
Institutional Source Beutler Lab
Gene Symbol Tspan3
Ensembl Gene ENSMUSG00000032324
Gene Nametetraspanin 3
SynonymsTM4-A, tetraspanin, Tm4sf8, tetraspanin TM4-A homolog, Tspan-3, 1700055K04Rik
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location56131725-56165477 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56136696 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 240 (R240W)
Ref Sequence ENSEMBL: ENSMUSP00000149496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034876] [ENSMUST00000215906]
Predicted Effect probably damaging
Transcript: ENSMUST00000034876
AA Change: R237W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034876
Gene: ENSMUSG00000032324
AA Change: R237W

DomainStartEndE-ValueType
Pfam:Tetraspannin 7 237 1.2e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214970
Predicted Effect probably damaging
Transcript: ENSMUST00000215906
AA Change: R240W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. Multiple alternative transcripts encoding different isoforms have been described. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased hematopoietic stem cell number and decreased leukemia incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Tspan3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02880:Tspan3 APN 9 56146516 missense possibly damaging 0.78
R0585:Tspan3 UTSW 9 56145932 splice site probably benign
R0608:Tspan3 UTSW 9 56147385 critical splice donor site probably null
R1067:Tspan3 UTSW 9 56160820 missense probably benign 0.01
R1368:Tspan3 UTSW 9 56147499 missense probably benign 0.08
R6727:Tspan3 UTSW 9 56147440 missense probably damaging 1.00
R7701:Tspan3 UTSW 9 56147519 nonsense probably null
R7995:Tspan3 UTSW 9 56147154 missense not run
Predicted Primers PCR Primer
(F):5'- CAGTGTACGTGTGCTTTGAC -3'
(R):5'- TCAGAGTTCCTGGGTATAAAGC -3'

Sequencing Primer
(F):5'- CTTTGACTAGATGAACTCAGGAGCC -3'
(R):5'- GCAGGAGCTACTTCTGGTAAATAG -3'
Posted On2015-10-08