Incidental Mutation 'R4673:Parp6'
ID348626
Institutional Source Beutler Lab
Gene Symbol Parp6
Ensembl Gene ENSMUSG00000025237
Gene Namepoly (ADP-ribose) polymerase family, member 6
Synonyms
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59617284-59650285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 59640110 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Proline at position 460 (R460P)
Ref Sequence ENSEMBL: ENSMUSP00000129456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026267] [ENSMUST00000050483] [ENSMUST00000167091] [ENSMUST00000216351]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026267
AA Change: R460P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000026267
Gene: ENSMUSG00000025237
AA Change: R460P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
Pfam:PARP 450 580 5.6e-15 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050483
AA Change: R440P

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000063065
Gene: ENSMUSG00000025237
AA Change: R440P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 303 315 N/A INTRINSIC
SCOP:d1a26_2 409 475 4e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167091
AA Change: R460P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129456
Gene: ENSMUSG00000025237
AA Change: R460P

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 175 189 N/A INTRINSIC
low complexity region 323 335 N/A INTRINSIC
SCOP:d1a26_2 429 473 4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214956
Predicted Effect probably damaging
Transcript: ENSMUST00000216351
AA Change: R440P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216482
Meta Mutation Damage Score 0.4019 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ofcc1 G A 13: 40,015,388 T841I probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Parp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Parp6 APN 9 59632959 missense probably damaging 1.00
IGL01366:Parp6 APN 9 59636713 missense possibly damaging 0.75
IGL01385:Parp6 APN 9 59630612 splice site probably benign
IGL02000:Parp6 APN 9 59648892 missense probably benign 0.00
IGL02001:Parp6 APN 9 59649961 missense possibly damaging 0.90
IGL02315:Parp6 APN 9 59641738 intron probably benign
IGL02719:Parp6 APN 9 59630738 missense probably benign 0.26
IGL02928:Parp6 APN 9 59641063 missense possibly damaging 0.70
IGL03169:Parp6 APN 9 59650017 nonsense probably null
IGL03398:Parp6 APN 9 59641053 missense probably damaging 0.97
R0165:Parp6 UTSW 9 59632925 missense probably damaging 1.00
R0602:Parp6 UTSW 9 59649365 splice site probably benign
R0781:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1110:Parp6 UTSW 9 59649564 missense probably damaging 0.99
R1730:Parp6 UTSW 9 59633538 nonsense probably null
R1783:Parp6 UTSW 9 59633538 nonsense probably null
R2264:Parp6 UTSW 9 59624005 missense probably damaging 1.00
R4323:Parp6 UTSW 9 59630686 missense possibly damaging 0.84
R4654:Parp6 UTSW 9 59641100 splice site probably null
R4672:Parp6 UTSW 9 59640110 missense probably damaging 1.00
R4708:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4709:Parp6 UTSW 9 59641769 missense probably damaging 0.98
R4763:Parp6 UTSW 9 59631365 missense probably damaging 1.00
R4782:Parp6 UTSW 9 59634984 splice site probably null
R4825:Parp6 UTSW 9 59624362 splice site probably null
R5563:Parp6 UTSW 9 59628673 splice site probably null
R5700:Parp6 UTSW 9 59624727 missense probably damaging 1.00
R6235:Parp6 UTSW 9 59630815 missense probably benign 0.34
R6269:Parp6 UTSW 9 59650012 missense probably benign
R6383:Parp6 UTSW 9 59623939 missense probably damaging 0.99
X0061:Parp6 UTSW 9 59630765 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GGGACTTTATGCCCATTCACC -3'
(R):5'- CCTTTATAGACCCTACCACAGTAG -3'

Sequencing Primer
(F):5'- AACTAGCTTGGTTGGTACTGCCC -3'
(R):5'- GCTGATTAGCCGACAATC -3'
Posted On2015-10-08