Incidental Mutation 'R4673:Ofcc1'
ID348638
Institutional Source Beutler Lab
Gene Symbol Ofcc1
Ensembl Gene ENSMUSG00000047094
Gene Nameorofacial cleft 1 candidate 1
SynonymsOpo, ojoplano
MMRRC Submission 041928-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4673 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location40001882-40361450 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40015388 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 841 (T841I)
Ref Sequence ENSEMBL: ENSMUSP00000062217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054635] [ENSMUST00000224909]
Predicted Effect probably damaging
Transcript: ENSMUST00000054635
AA Change: T841I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062217
Gene: ENSMUSG00000047094
AA Change: T841I

DomainStartEndE-ValueType
Pfam:OFCC1 5 113 1.3e-57 PFAM
transmembrane domain 575 592 N/A INTRINSIC
transmembrane domain 599 618 N/A INTRINSIC
transmembrane domain 633 655 N/A INTRINSIC
transmembrane domain 667 689 N/A INTRINSIC
transmembrane domain 721 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224909
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal skull morphology and normal behavior with in increase in gamma-glutamyl transpeptidase. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,884,455 E507G probably damaging Het
Adam39 C T 8: 40,824,731 T53I probably benign Het
Adam4 A T 12: 81,421,761 S29T possibly damaging Het
Adamdec1 C A 14: 68,577,904 E104* probably null Het
Alas1 G T 9: 106,236,477 P523Q probably damaging Het
Aldh3a1 A G 11: 61,213,494 D69G probably benign Het
Arhgap29 T A 3: 122,014,971 V1266E probably damaging Het
Bcdin3d T C 15: 99,470,838 D160G probably damaging Het
Btaf1 T A 19: 36,978,372 F569I probably benign Het
Cacna1b A G 2: 24,631,944 L1718S probably damaging Het
Casd1 A G 6: 4,629,975 Y457C probably damaging Het
Creb3 T C 4: 43,563,192 V97A probably benign Het
Cux2 G T 5: 121,887,476 S43* probably null Het
Fam160a1 A T 3: 85,730,713 V93D probably damaging Het
Fsbp T G 4: 11,579,841 N36K probably benign Het
Gm11565 A G 11: 99,915,214 D144G probably benign Het
Gm7534 G A 4: 134,200,347 A365V probably benign Het
Gpn3 A G 5: 122,373,918 Y19C probably damaging Het
Gstz1 A T 12: 87,162,063 T148S probably benign Het
Gtf3c5 A G 2: 28,572,224 I282T probably benign Het
Hspa2 T A 12: 76,405,740 S403T possibly damaging Het
Il27 G A 7: 126,591,079 T121I possibly damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Kctd1 T A 18: 15,063,227 probably benign Het
Kynu A G 2: 43,679,803 T366A probably damaging Het
Lama5 G A 2: 180,199,266 T507I probably damaging Het
Myh11 C T 16: 14,269,241 V124M probably damaging Het
Myh14 T A 7: 44,624,330 H1331L probably damaging Het
Myh2 T A 11: 67,188,477 L957Q probably damaging Het
Myh4 T C 11: 67,246,401 F483L probably benign Het
Nbeal1 A C 1: 60,329,390 K2631N probably damaging Het
Ogg1 T C 6: 113,327,307 C28R probably damaging Het
Olfr1449 G A 19: 12,935,097 A120T probably damaging Het
Olfr157 T C 4: 43,836,430 H20R probably benign Het
Olfr181 C T 16: 58,925,690 V294I possibly damaging Het
Olfr49 C T 14: 54,282,332 A188T possibly damaging Het
Olfr855 A G 9: 19,585,430 K298E possibly damaging Het
Parp6 G C 9: 59,640,110 R460P probably damaging Het
Phf14 A G 6: 11,992,057 H744R probably damaging Het
Pibf1 A G 14: 99,133,351 N263S possibly damaging Het
Plcb4 A G 2: 135,932,271 T158A possibly damaging Het
Plce1 T C 19: 38,749,396 S1615P possibly damaging Het
Plxna3 T G X: 74,338,948 probably null Het
Rad54b T A 4: 11,609,449 H633Q probably benign Het
Rgs22 T A 15: 36,099,933 Y212F probably benign Het
Rnd3 G A 2: 51,132,541 A163V probably benign Het
Rnf10 A T 5: 115,251,089 V315E probably damaging Het
Robo2 C T 16: 73,904,378 probably null Het
Rp1l1 T G 14: 64,031,270 V1435G probably damaging Het
Scaf8 T A 17: 3,197,985 D1194E probably benign Het
Sept12 T C 16: 4,991,943 T198A probably damaging Het
Shisa2 A G 14: 59,630,180 T294A probably damaging Het
Spta1 A G 1: 174,191,062 probably null Het
Strbp A T 2: 37,645,679 S6T probably damaging Het
Syf2 A G 4: 134,934,493 E56G probably damaging Het
Thap4 T C 1: 93,714,866 probably benign Het
Tnfaip3 T C 10: 19,011,832 probably benign Het
Tnxb A G 17: 34,672,540 E619G probably damaging Het
Tpr G A 1: 150,423,567 A1173T probably benign Het
Tspan3 G A 9: 56,136,696 R240W probably damaging Het
Ubr4 C T 4: 139,410,716 S1128L probably damaging Het
Ucp1 T C 8: 83,295,247 V236A probably damaging Het
Usp34 TCACCACCACCACCACCACCACCACCAC TCACCACCACCACCACCACCACCAC 11: 23,364,480 probably benign Het
Zcchc6 G T 13: 59,796,845 T658K probably damaging Het
Zfp940 T C 7: 29,845,438 D348G probably benign Het
Other mutations in Ofcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Ofcc1 APN 13 40142804 missense probably damaging 0.97
IGL00489:Ofcc1 APN 13 40280491 missense probably damaging 1.00
IGL01952:Ofcc1 APN 13 40280861 missense probably damaging 1.00
IGL02126:Ofcc1 APN 13 40208775 missense probably benign
IGL02619:Ofcc1 APN 13 40097077 missense possibly damaging 0.68
IGL03069:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03133:Ofcc1 APN 13 40072768 missense probably benign 0.36
IGL03273:Ofcc1 APN 13 40180525 missense probably damaging 1.00
IGL03343:Ofcc1 APN 13 40072664 missense probably benign 0.38
IGL03349:Ofcc1 APN 13 40072752 missense probably benign 0.13
IGL03399:Ofcc1 APN 13 40142838 missense possibly damaging 0.56
LCD18:Ofcc1 UTSW 13 40092967 intron probably benign
R0122:Ofcc1 UTSW 13 40280556 splice site probably null
R0320:Ofcc1 UTSW 13 40206696 missense probably benign 0.01
R0386:Ofcc1 UTSW 13 40214474 nonsense probably null
R0390:Ofcc1 UTSW 13 40015313 missense possibly damaging 0.85
R0829:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0866:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0945:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R0981:Ofcc1 UTSW 13 40072698 missense probably damaging 1.00
R1055:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1056:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1186:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1187:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1400:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1411:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R1419:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1474:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1636:Ofcc1 UTSW 13 40180428 missense possibly damaging 0.86
R1691:Ofcc1 UTSW 13 40208829 missense probably benign 0.00
R1886:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R1887:Ofcc1 UTSW 13 40206624 missense possibly damaging 0.88
R2176:Ofcc1 UTSW 13 40097119 missense probably benign
R2189:Ofcc1 UTSW 13 40180448 missense probably benign
R2242:Ofcc1 UTSW 13 40142787 missense probably benign 0.02
R2255:Ofcc1 UTSW 13 40094705 missense probably damaging 0.99
R2471:Ofcc1 UTSW 13 40097025 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40072760 missense probably damaging 1.00
R2863:Ofcc1 UTSW 13 40087938 missense possibly damaging 0.56
R4366:Ofcc1 UTSW 13 40015461 missense probably benign 0.18
R4573:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4574:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4656:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4657:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4782:Ofcc1 UTSW 13 40001892 synonymous probably null
R4790:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4823:Ofcc1 UTSW 13 40280473 missense probably damaging 0.99
R4834:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4840:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4842:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4889:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4919:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4920:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4921:Ofcc1 UTSW 13 40214517 missense probably benign 0.10
R4948:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4953:Ofcc1 UTSW 13 40015388 missense probably damaging 1.00
R4961:Ofcc1 UTSW 13 40263559 critical splice donor site probably null
R5339:Ofcc1 UTSW 13 40087845 missense probably benign 0.35
R5512:Ofcc1 UTSW 13 40206810 missense probably benign 0.20
R5566:Ofcc1 UTSW 13 40094653 missense probably damaging 1.00
R5672:Ofcc1 UTSW 13 40280429 missense probably damaging 0.98
R5734:Ofcc1 UTSW 13 40087849 missense probably damaging 1.00
R5839:Ofcc1 UTSW 13 40280545 missense probably damaging 1.00
R5853:Ofcc1 UTSW 13 40206717 missense probably benign 0.00
R5896:Ofcc1 UTSW 13 40180584 missense probably benign 0.01
R5909:Ofcc1 UTSW 13 40263578 missense possibly damaging 0.92
R5995:Ofcc1 UTSW 13 40280422 missense probably damaging 1.00
R6306:Ofcc1 UTSW 13 40148576 missense probably benign
R6460:Ofcc1 UTSW 13 40287979 missense probably damaging 0.99
R6504:Ofcc1 UTSW 13 40097055 missense probably damaging 1.00
R6797:Ofcc1 UTSW 13 40087947 missense possibly damaging 0.75
R7091:Ofcc1 UTSW 13 40072767 missense probably damaging 0.99
R7098:Ofcc1 UTSW 13 40003966 critical splice donor site probably null
R7142:Ofcc1 UTSW 13 40004062 missense probably benign 0.00
R7240:Ofcc1 UTSW 13 40208841 missense probably benign
R7589:Ofcc1 UTSW 13 40255484 missense probably benign 0.13
R7792:Ofcc1 UTSW 13 40142826 missense probably damaging 0.99
R7852:Ofcc1 UTSW 13 40180439 missense probably damaging 1.00
R7935:Ofcc1 UTSW 13 40180439 missense probably damaging 1.00
X0005:Ofcc1 UTSW 13 40142790 missense probably benign 0.01
X0005:Ofcc1 UTSW 13 40280532 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCATCAGGTTTAAGTTCACAC -3'
(R):5'- GTGGAAAATTGACTTTGTTCCTGAC -3'

Sequencing Primer
(F):5'- GGTTTAAGTTCACACATTTAAGAACG -3'
(R):5'- GGCAGTGCACGATTACAT -3'
Posted On2015-10-08